Aggressive inherited and sporadic medullary thyroid carcinomas display similar oncogenic pathways

in Endocrine-Related Cancer

RET oncogene mutations are found in familial medullary thyroid carcinomas (MTC) and in one-third of sporadic cases. Oncogenic mechanisms involved in non-RET mutated sporadic MTC remain unclear. To study alterations associated with the development of both inherited and sporadic MTC, pangenomic DNA microarrays were used to analyze the transcriptome of 13 MTCs (four familial and nine sporadic). By using an ANOVA test, a list of 173 gene sequences with at least a twofold change expression was obtained. A subset of differentially expressed genes was controlled by real-time quantitative PCR and immunohistochemistry on a larger collection of MTCs. The expression pattern of those genes allowed us to distinguish two groups of sporadic tumors. The first group displays an expression profile similar to that expressed by inherited RET634 tumors. The second presents an expression profile close to that displayed by inherited RET918 tumors and includes tumors from patients with distant metastases. It is characterized by the overexpression of genes involved in proliferation and invasion (PTN, ESM1, and CEACAM6) or matrix remodeling (COL1A1, COL1A2, and FAP). Interestingly, RET918 tumors showed overexpression of the PTN gene, encoding pleiotrophin, a protein associated with metastasis. Using a MTC cell line, silencing of RET induced the inhibition of PTN gene expression. Overall, our results suggest that familial MTC and sporadic MTC could activate similar oncogenic pathways.

Abstract

RET oncogene mutations are found in familial medullary thyroid carcinomas (MTC) and in one-third of sporadic cases. Oncogenic mechanisms involved in non-RET mutated sporadic MTC remain unclear. To study alterations associated with the development of both inherited and sporadic MTC, pangenomic DNA microarrays were used to analyze the transcriptome of 13 MTCs (four familial and nine sporadic). By using an ANOVA test, a list of 173 gene sequences with at least a twofold change expression was obtained. A subset of differentially expressed genes was controlled by real-time quantitative PCR and immunohistochemistry on a larger collection of MTCs. The expression pattern of those genes allowed us to distinguish two groups of sporadic tumors. The first group displays an expression profile similar to that expressed by inherited RET634 tumors. The second presents an expression profile close to that displayed by inherited RET918 tumors and includes tumors from patients with distant metastases. It is characterized by the overexpression of genes involved in proliferation and invasion (PTN, ESM1, and CEACAM6) or matrix remodeling (COL1A1, COL1A2, and FAP). Interestingly, RET918 tumors showed overexpression of the PTN gene, encoding pleiotrophin, a protein associated with metastasis. Using a MTC cell line, silencing of RET induced the inhibition of PTN gene expression. Overall, our results suggest that familial MTC and sporadic MTC could activate similar oncogenic pathways.

Introduction

Medullary thyroid carcinoma (MTC) derives from thyroid C cells, a neuroendocrine cell that produces calcitonin and represents <1% of all thyroid cells (Leboulleux et al. 2004, Matias-Guiu et al. 2004, Hoff & Hoff 2007). MTC accounts for 5–10% of all thyroid cancers and occurs as either a sporadic form or in a familial context (25% of cases). Hereditary MTC is transmitted with an autosomal dominant pattern, either as an isolated form, familial MTC (FMTC), or as part of a multiple endocrine neoplasia type 2A (MEN2A) or type 2B (MEN2B). MEN2A comprises MTC, pheochromocytoma, and hyperparathyroidism. MEN2B consists of a MTC that is often aggressive, pheochromocytoma, ganglioneuromatosis, Marfan syndrome features, and skeletal abnormalities (Bachelot et al. 2002, Ball 2007).

The RET proto-oncogene is a cell-surface receptor tyrosine kinase for glial cell line-derived neurotrophic factor (GDNF) family ligands. RET transduces signals via its intracellular phosphorylated domains leading to the activation of several pathways (Ras/ERK, PI3K/Akt, etc.), resulting in cell growth, differentiation, neuron survival, and development (Manie et al. 2001, Kurokawa et al. 2003, Santoro et al. 2004). Mutations which activate RET are responsible for the familial forms of MTC, MEN2A being mainly due to germline RET634 mutation, and MEN2B being mainly due to germline RET918 mutation (Ponder 1999). Mutations which activate RET, mainly the RET918 mutation, are also detected in one-third of sporadic tumors (Donis-Keller et al. 1993, Manie et al. 2001). However, the development mechanisms of RET-mutated tumors as well as the oncogenic pathways involved in non-RET mutated sporadic MTC remain largely unknown.

The knowledge of induced genetic alterations in the various forms of MTC is essential for understanding the pathways involved in the development and progression of MTC with various phenotypes. It is also mandatory for the identification of molecular targets that could be used for new therapeutic strategies, particularly in the aggressive forms for which conventional therapies are poorly effective (Schlumberger et al. 2008). Few studies based on high-throughput microarray or differential display methods compared gene expression changes in MTC hereditary or sporadic forms (Watanabe et al. 2002, Jain et al. 2004, Musholt et al. 2005).

In this context, the present work was designed to explore gene expression changes associated with the development of both inherited and sporadic MTC, using 60-mer oligonucleotide microarrays. A subset of differentially expressed genes discriminated between RET634, RET918 and sporadic tumors.

MTC RET634 displayed an expression profile similar to that of sporadic MTC from patients without metastases. MTC RET918 and sporadic MTC from patients with distant metastases expressed a similar molecular signature characterized by the overexpression of genes involved in proliferation and invasion. These results suggest that MTC, occurring in either a familial or sporadic context, could activate similar oncogenic pathways independently of RET mutations.

Materials and methods

Tumor samples

Thyroid samples from 46 patients and their non-tumoral contralateral thyroid tissue were obtained from the Biobank at Institut Gustave-Roussy. They consisted of MTC and C cell hyperplasia (CCH). All tissue specimens were selected after histological analysis, classified according to World Health Organization recommendations (Matias-Guiu et al. 2004), and stored frozen in liquid nitrogen. The study was approved by the local human studies ethic committee. The histological and biological features as well as the clinical records of patients were obtained from the Pathological and Laboratory Medicine Department and the Nuclear Medicine Department at Institut Gustave-Roussy respectively.

Cell line

Thyroid tumor (TT) cell line, derived from a human MTC and carrying the RET634 mutation, was obtained from the American Type Culture Collection (Zabel & Grzeszkowiak 1997). Cells were cultured in RPMI Medium (Gibco, Invitrogen) supplemented with antibiotics and 10% FCS (Invitrogen).

RNA and DNA preparation

Total RNA and DNA were isolated by Qiagen RNeasy micro KIT and Qiagen DNeasy tissue KIT respectively (Qiagen), according to the manufacturer's protocols. Quality of RNA preparation, based on the 28S/18S rRNAs ratio, was assessed using the RNA 6000 Nano Lab-On-Chip, as developed on the Agilent 2100 Bioanalyzer device (Agilent Technologies, Palo Alto, CA, USA). All specimens included in this study displayed a ratio of 28S to 18S higher than 1.5. RNA and DNA samples were frozen in nuclease-free water.

Genomic DNA sequencing

Samples were screened for RET mutational status. The seven mostly mutated exons (8, 10, 11, 13, 14, 15, and 16) were amplified using standard PCR from 200 ng DNA, with the following conditions: denaturation at 97 °C for 15 min, 40 cycles of denaturation at 97 °C for 1 min, annealing at 68–72 °C for 30 s, and elongation at 72 °C for 1 min, final elongation at 72 °C for 10 min. Primers sequences are described in Table 1. All PCR products were visualized by electrophoresis on a 1% agarose gel, and sequencing used the BigDye Terminator sequencing kit (Applied Biosystems, Foster City, CA, USA). Products were purified on a Sephadex G50 resin (Amersham Biosciences) and were analyzed on an automated sequencer 3730 DNA Analyzer (Applied Biosystems).

Table 1

RET primer sequences

RET exonPrimers
8F: 5′ CTCCATCCGTGGGCAGCTCAG 3′
R: 5′ GGCCCCAGGACCCCGTTTC 3′
10F: 5′ CCTTGGGACACTGCCCTGGAAATATG 3′
R: 5′ GCTGTTAGGACCTCTGTGGGGCTG 3′
11F: 5′ CAGAGCATACGCAGCCTGTACCCAGT 3′
R: 5′ CCCCTCACAGGATGGCCTCTGTC 3′
13F: 5′ GGAGAAGCCTCAAGCAGCATCGT 3′
R: 5′ CAGGAGCAGTAGGGAAAGGGAGAAAGA 3′
14F: 5′ GGCTTCAAGGTCTGCGCTCTCCACA 3′
R: 5′ GCAGGGGCATGGTGGGCTAGAGTGT 3′
15F: 5′ CCCGGCCCAGGTCTCACCA 3′
R: 5′ TCTTTCCTAGGCTTCCCAAGGGCACT 3′
16F: 5′ TGTCTACAGCACTCCTCTGGTTACTGA 3′
R: 5′ GCGTCGTGGCCCCACTACA 3′

Microarray analysis

Thirteen MTC samples were used for microarray experiments on the basis of RNA quality and tumoral cell percentage in tissue sample (>80%). A pool composed of equal amounts of total RNA from each tissue sample was used as the RNA reference. Reverse transcription, linear amplification, cRNA labeling, and purification were performed using the Agilent Linear amplification kit (Agilent Technologies). 500 ng aliquots of total RNA were used to generate antisense cRNA labeled with Cyanine 3 (Cy3)-CTP or cyanine 5 (Cy5)-CTP (Perkin–Elmer NEN, Boston, MA, USA), as previously described (Lacroix et al. 2005). Custom-designed 60-mer oligonucleotide microarrays of 44 000 sequences (Agilent Technologies) were used for hybridization during 17 h at 60 °C, in a dye-swap procedure (Lacroix et al. 2005). After washing and drying procedures, microarray slides were scanned with an Agilent Technologies Scanner.

Bioinformatic analysis

Image analysis, quantification of fluorescence intensities, and normalization of data using the local background subtraction option were performed with Feature Extraction software (Agilent Technologies). Microarray data analysis was performed using Resolver software (Rosetta Inpharmatics, Kirkland, WA, USA). One-way ANOVA test based on RET634 versus RET918 mutation was used to analyze genes differentially expressed in the different groups of MTC. Selected genes had at least a twofold change, with a P value ≤10−3. All data obtained from microarray analysis have been submitted to Array Express at the European Bioinformatics Institute (http://www.ebi.ac.uk/arrayexpress/).

Reverse transcription and real-time quantitative PCR

One microgram of total RNA from each sample was reverse transcribed by superscript II reverse transcriptase (Invitrogen) in the presence of random primers (Applied Biosystems). Quantitative PCR (Q-PCR) was performed on an equivalent amount of 10 ng per total RNA per tube in a final volume of 25 μl (Lacroix et al. 2005). The reference pool, corresponding to all samples included in the Q-PCR experiment, was used as a calibrator. Oligonucleotide primers and TaqMan probes specific for each amplified gene were designed to be intron spanning. CALCA, EPOR, endothelial cell specific molecule 1 (ESM1), ACTB, RPLPO, and 18S were designed using the PrimerExpress computer software (Applied Biosystems) and purchased from MWG Biotech (Courtaboeuf, France). Primers and probes for PTN, GEM, POMC, ITGAV, KAZALD1, and IRS2 genes were obtained from Assays-On-Demand (Applied Biosystems).

Tissue array and immunohistochemistry

Tissue microarrays (TMAs) including all 46 samples were constructed using a tissue-arrayer device (Alphelys, Plaisir, France) with a 1 mm needle. Quadruplicate samples, for a total of 368 spots, were prepared from both the tumor and the non-tumoral thyroid tissue taken at a distance from the tumor (Lacroix et al. 2005).

Immunohistochemistry was performed on formalin-fixed paraffin-embedded 5 μm sections of the three TMA, with the DAKO LSAB System procedure (DAKO, Carpinteria, CA, USA), as previously described (Lacroix et al. 2005). Sections were incubated for 30 min at room temperature with antibodies against calcitonin, thyroglobulin (Dako Cytomation Norden, Glostrup, Danemark), pleiotrophin (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), ESM1 (Endotis Pharma, Romainville, France), proopiomelanocortin (‘clone 3-E7’, Bachem, San Carlos, CA, USA), and Cyclin D1 (NeoMarkers, Fremont, CA, USA), according to the manufacturer's recommendations. Negative controls were obtained by performing the same procedure on tissue sections without the primary antibody incubation step.

Cell transfection

TT cells were transfected using the Nucleofector transfection KIT (Amaxa, Cologne, Germany) on the Nucleofector transfector (Amaxa) with recommended program L-029 following the manufacturer's protocol. About 6 μg of RET siRNA (Dharmacon, Lafayette, CO, USA) or stealth siRNA (Invitrogen) were used to transfect 2.5×106 cells. Control cells were treated in the same conditions in the absence of siRNA. After transfection, cells were cultured in a 6 cm2 plate with complete medium at different times (24, 48, 72, and 96 h). Cells were collected after trypsination/PBS wash and centrifugation (×500 g/5 nm), and pellets disrupted by adding RNA extraction buffer, RLT (Qiagen).

Results

RET mutational status

Among the 46 C cell tumors, 41 were classified as MTC, 1 as a mixed MTC and follicular thyroid carcinoma, 1 as a micro MTC, and 3 as a CCH. Twenty-one patients displayed a germline RET mutation: RET634 mutation in 11 samples, including nine MTC (germline RET634 MTC), the mixed carcinoma, and the micro MTC; RET918 mutation (germline RET918 MTC) in three MTC. Other germline mutations involved codons 611, 618, 620, and 790 of RET (Table 2). Among the 25 sporadic MTC, nine exhibited somatic RET918 mutation and were designated as sporadic RET918 MTC. No other RET mutations were identified in the 16 remaining sporadic tumors that were designed as sporadic MTC RETwt (Table 2).

Table 2

Clinical and histological features of tumor samples

CaseDiagnosisTypeAge at diagnosisSexRET mutationOrigin/syndromeTNM stageMetastases localization
1MTCPrimary19FC634S TGC (T/A)GerminalT1(m)N0M0
2MTCPrimaryFC634S TGC (T/A) GerminalT1(m)N0M0
3MTCPrimary38FC634S TGC (T/A)MEN2AT1(m)N1M0
4Micro MTCPrimary8MC634S TGC (T/A)GerminalT1N1M0
5MTCPrimary24FC634Y TGC (G/A)MEN2AT3(m)N1M0
6MTCPrimary48MC634Y TGC (G/A)MEN2AT1(m)N1Mx
7MTCPrimary20FC634Y TGC (G/A)GerminalT1N0M0
8MTCPrimary22FC634Y TGC (G/A)GerminalT3(m)N1bM0
9MTCPrimary32FC634A TGC (T/C)MEN2AT1(m)N0M0
10MTCPrimary7FC634A TGC (T/C)GerminalT1N0M0
11Mixed MTC/FTCPrimary10MC634W TGC (C/G)GerminalT3N0Mx
12MTCPrimary21FC611Y TGC (G/A)GerminalT1N1M0
13CCHPrimary31MC611Y TGC (G/A)Germinal/
14MTCPrimary59FC618S TGC (G/C)GerminalT1N1Mx
15CCHPrimary4FC618S TGC (G/C)Germinal/
16MTCPrimary39MC620Y TGC (G/A)GerminalT1(m)N0M0
17MTCPrimary73FL790F TGC (G/T)GerminalT1(m)N0M0
18MTCPrimary50FL790F TGC (G/T)GerminalT1(m)N0M0
19MTCPrimary25FM918T ATG (T/C)MEN2BT2(m)N1M0
20MTCPrimary11FM918T ATG (T/C)GerminalT1(m)N1M0
21MTCPrimary8MM918T ATG (T/C)MEN2BT1(m)N1M0
22MTCNode metastases46MM918T ATG (T/C)SporadicTxN1M1Lung, liver
23MTCNode metastases45MM918T ATG (T/C)SporadicTxN1M1Liver, bone
24MTCPrimary32MM918T ATG (T/C)SporadicT1(m)N1M1Lung, liver
25MTCPrimary53MM918T ATG (T/C)SporadicT3(m)N1M1Lung, liver
26MTCPrimary42FM918T ATG (T/C)SporadicT2N0M0
27MTCNode metastases27MM918T ATG (T/C)SporadicTxN1M1Bone
28MTCPrimary49FM918T ATG (T/C)SporadicT3N1bM0
29MTCPrimary51MM918T ATG (T/C)SporadicT3N1M0
30MTCPrimary65FM918T ATG (T/C)SporadicT1N1M1Liver, bone
31MTCPrimary60MWTSporadicT2N1M1Liver, neck
32MTCPrimary49FWTSporadicT2(m)N1M1Bone
33MTCNode metastases45FWTSporadicTxN1M1Bone, brain
34MTCPrimary49MWTSporadicT4N1bM1Lung, bone
35MTCPrimary21MWTSporadicT4a(m)N1M1Lung, liver, bone
36MTCPrimary39MWTSporadicT1N1M1Lung, bone, brain
37MTCPrimary74MWTSporadicT4aN1M1Liver, bone
38MTCPrimary51FWTSporadicT1N0M0
39MTCPrimary64MWTSporadicT3(m)N1M1Lung, liver, bone
40MTCPrimary63FWTSporadicT1N0M0
41MTCPrimary59FWTSporadicT1N0M0
42MTCNode metastases45FWTSporadicTxN1M0
43MTCPrimary59FWTSporadicT1N0Mx
44MTCNode metastases61MWTSporadicTxN1M1Lung
45MTCPrimary69MWTSporadicT1(m)N1bMx
46CCHPrimary53MWTSporadicT1(m)N0M0

Gene expression profile associated with germline and sporadic MTC

Microarray experiments were performed on 13 MTC, including four hereditary and nine sporadic MTC. Two hereditary tumors displayed RET634 mutation and two had RET918 mutation; two sporadic MTC presented a RET918 mutation and the seven others did not have any identifiable RET mutation (RETwt). All samples were characterized for their RNA quality (ratio RNA 18S/28S=1.5–2) and for their high tumor cell population (>80%).

A total of 173 gene sequences were identified as differentially expressed between RET634 and RET918 MTC by ANOVA test with a fold change level higher than 2 and a P value ≤10−3 (Fig. 1). Among these 173 gene sequences, 17 correspond to replicate sequences and 20 correspond to genes with unknown function. Classification of the 13 MTC, with or without RET mutation, and based on those 173 sequences, divided the tumors in two groups: the first group included the two germline RET634 MTC and three sporadic RETwt MTC, whereas the second group included the two germline RET918 MTC, two sporadic RET918 MTC, and four sporadic RETwt MTC. Interestingly, the sporadic RETwt MTC in each groups differed according to the clinical features of patients. Indeed, in the first group, the three sporadic RETwt MTC arose from patients without lymph node or distant metastasis (Table 2). In contrast, the four sporadic RETwt MTC, which segregated with sporadic and germline RET918 MTC, were from patients bearing lymph nodes and distant metastases (Table 2).

Figure 1
Figure 1

Heat map representing the genes identified as differentially expressed between RET634/RET918 MTC in the 13 medullary thyroid carcinoma samples. The clustering of the 173 gene sequences is based on the RET634/RET918 set of genes determined by the ANOVA test, with criteria of fold change ≥2 and P value ≤10−3. Red or green color scales represent respectively up- and down-regulated genes in comparison with the reference. Each line corresponds to a gene and each column corresponds to a MTC sample (G634, tumors from patient with germline RET634 mutation; G918, tumors from patient with germline RET918 mutation; S918, tumors from patient with somatic RET918 mutation, SWT, tumors from patient without RET mutation).

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0289

In the first group, major up-regulated genes were those involved in cell survival signaling such as GEM, encoding a small GTPase of RAS-related GTP-binding proteins family, NR4A1, and NR4A2, encoding for nuclear receptor subfamily 4, group A, members 1 and 2 respectively. Other up-regulated genes were genes coding for activating transcription factors (BHLHB3, JUNB, and ATF3) and genes mediating intracellular signaling (ITGAV, CAV1, EGR1, and EGR3; Table 3). In the second group, which contained both germline and sporadic RET918 MTC and RETwt MTC with distant metastasis, up-regulated genes were associated with cell migration and proliferation, such as ESM1, SPOCK1 (testican), RASGEF1A (a small GTP-binding proteins of the Ras super family), and matrix remodeling such as COL1A1 and COL1A2, encoding for collagen type 1 α-1 and -2, Cadherin 11 (CDH11), the fibroblast activation protein FAP, and FBLN1, an extracellular matrix protein. The POMC gene, encoding proopiomelanocortin, a pro ACTH–endorphin molecule synthesized by the anterior pituitary gland, displayed a significant over expression. Finally, in the germline RET918 MTC group, PTN gene coding for pleiotrophin, a neurite outgrowth-promoting factor, and KAZALD1, a KAZAL-type protease inhibitor domain, also designated BONO1 for bone and odontoblast-expressed gene 1, were significantly up-regulated (Table 3).

Table 3

Main up-regulated genes in the different medullary thyroid carcinoma (MTC) groups

Group of tumorsGenes
Germline RET634 MTCGEM, NR4A1 and NR4A2, PCDH11y
1Germline RET634 MTC and sporadic RETwt MTC (without metastases)ITGAV, CAV1, BHLHB3, ATF3, JUNB, NTRK2, IER2, NCOA7, COL17A1, MAPK10, EGR1 and EGR3
Germline RET918 MTCPTN, KAZALD1, LAMB2
2Germline and sporadic RET918 MTC and sporadic RETwt MTC (with metastases)ESM1, POMC, CEACAM6 and CEACAM7, GHRL, COL1A1 and COL1A2, FAP, CDH11, RASGEF1A, FBLN1, SPOCK, CIT

Functional pathway analysis was performed using Ingenuity software (Ingenuity Systems, Redwood City, CA, USA). The most significant pathway was represented by the integrin signaling pathway, which was overexpressed in the MTC RET634 and the sporadic RETwt MTC without metastases.

Quantitative gene expression analysis

Q-PCR was carried out to confirm changes in the expression of 11 genes selected on the basis of increased fold change. This analysis was done on a series of 22 MTC, including the 13 MTC analyzed in the microarray study, and nine additional samples comprising five germline MTC displaying RET mutations at position RET634 (n=2), RET611 (n=1), RET620 (n=1), RET918 (n=1), and four sporadic RETwt MTC, two obtained from patients with metastases and the other two from patients without metastasis. The TT cell line was also included in this study. The values were normalized using housekeeping genes (RPLPO and 18S) and compared with a pool of all samples.

Among the most up-regulated genes in the germline RET634 MTC group, GEM, BHLHB3, and ITGAV genes were found to be increased in the Q-PCR analysis (Fig. 2). Upregulation of NR4A1 and PCDH11y genes was also confirmed (data not shown). Interestingly, two genes, EPOR and IRS2, which displayed less than a twofold change with P value ≤10−3, were found to be mainly increased in RET634 MTC. In the group defined by both germline and sporadic RET918 MTC and sporadic metastatic RETwt MTC, the expression of PTN, ESM1, KAZALD1, and POMC genes was confirmed as up-regulated. It was particularly striking that PTN and ESM1 genes were highly increased in sporadic RET918 MTC. The POMC gene expression was also significantly up-regulated in both sporadic RET918 MTC and metastatic RETwt MTC. Finally, the TT cell line exhibited a particular gene expression profile with high levels of GEM, EPOR, PTN, and KAZALD1 genes expression, in contrast to ESM1 and POMC genes whose expression was not detected.

Figure 2
Figure 2

Validation of gene expression changes using quantitative PCR. Gene expression is measured by real-time quantitative PCR normalized with two housekeeping genes (RPLPO and 18S). G634 refers to tumor samples from patients with germline RET cysteine codon mutation (634, 611, or 6220); G918 refers to tumor samples from patients with germline RET918 mutation; S918 refers to tumor samples from patients with somatic RET918 mutation; SWT M1 refers to tumor samples from patients without RET mutation and with distant metastases; SWT M0 refers to tumor samples from patients without RET mutation and without distant metastases.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0289

Immunohistochemistry

Tissue array allowed an extensive immunohistochemical analysis of C cell tumors (n=46) and their non-tumoral contralateral tissue, including tissue specimens tested in the microarray experiments. In order to control the histotype and to estimate the percentage of tumor cells, all samples were immunostained for calcitonin and thyroglobulin. Pleiotrophin, proopiomelanocortin, ESM1, and cyclin D1 protein expressions were then examined and results are presented in Fig. 3.

Figure 3
Figure 3

Immunostaining of calcitonin, cyclin D1, pleiotrophin, ESM1, and proopiomelanocortin proteins in medullary thyroid carcinomas. A tissue microarray including 46 tissue samples was constructed as described in Materials and methods. Immunostaining is presented at magnification of (A) ×25 for a MTC sample (right) and its contralateral non-tumoral tissue (left), and (B) ×100 for the corresponding MTC sample. Calcitonin immunostaining in tumor cells was found to be cytoplasmic and heterogeneous; most of tumors cells were strongly stained and a subpopulation showed a weak staining. A strong positivity was observed for Cyclin D1 protein in the nuclei of tumor cells. A strong and heterogeneous cytoplasmic staining was observed with the pleiotrophin antibody, particularly on a subpopulation displaying an intense staining. Finally, ESM1 and proopiomelanocortin staining was located in the cytoplasm, showing a particular granular staining for proopiomelanocortin. No staining was detected in contralateral non-tumoral thyroid tissue.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0289

Pleiotrophin immunostaining showed a characteristic cytoplasmic localization that was predominantly observed in both germline and sporadic RET918 MTC and in metastatic RETwt MTC. Staining was inconstantly observed in germline RET634 MTC and was slight or absent in other tumors as well as in non-tumoral contralateral tissues. ESM1 protein staining was particularly strong in both sporadic RET918 and RETwt metastatic MTC, and it was weak in some germline RET634 and RET918 MTC. Proopiomelanocortin displayed a cytoplasmic and granular staining that was observed in both germline and sporadic RET918 MTC and in metastatic RETwt MTC. Proopiomelanocortin staining was also observed in germline RET634 MTC and in nonmetastatic RETwt MTC. Finally, Cyclin D1 immunostaining was positive in all MTC and negative in CCH tissues.

siRNA RET transfection

To assess the consequences of RET inhibition on the expression of the selected genes, siRNA RET transfection was performed on the TT cell line. The expression of RET mRNA, as analyzed by Q-PCR, was abolished from 24 to 96 h posttransfection; RET gene expression level was then <10% of the level observed for the control and siRNA control-transfected groups (Fig. 4A).

Figure 4
Figure 4

Gene expression analysis after RET siRNA treatment of TT cells. (A) Control, TT cells without siRNA transfection; siRNA control, TT cells transfected with siRNA control targeting a noncoding sequence; siRNA RET, TT cells transfected with siRNA targeting RET. (B) Cells were treated with siRNA RET and siRNA control at different times. Control without transfection was standardized to 1. At 96 h posttransfection, siRNA control treatment did not decrease gene expression and no effect was observed on ACTB and EPOR gene expression after siRNA RET treatment. RET transcript inhibition significantly decreased CALCA, PTN, and GEM gene expressions.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0289

After siRNA RET transfection, ACTB gene expression remained unchanged, whereas expression of CALCA gene was reduced by 50 and 90% at 48 and 96 h respectively (Fig. 4B). PTN gene expression was reduced to 60 and 30% of its basal level after 48 and 96 h posttransfection respectively. Similarly, the expression level of the GEM mRNA was reduced by 55% at 96 h posttransfection (Fig. 4B). CCND1 gene expression showed a 40% decrease after inhibition of RET until 96 h posttransfection (data not shown). Several other genes were investigated: at 96 h posttransfection, ITGAV gene showed a 40% reduction of its expression, while the expression of EPOR (Fig. 4B), IRS2, and BHLHB3 (data not shown) genes remain unchanged.

Discussion

Tumor mutations in the RET oncogene are found in FMTC and in 25–30% of sporadic MTC. However, other genes and mechanisms involved in the tumoral MTC process are unclear, and genetic alterations occurring in most sporadic MTC remain unknown. MTC is a rare disease with a slow progression rate, but prognosis may be poor for aggressive forms, including the MEN2B syndrome that is due to RET918 mutation (Bachelot et al. 2002, Ball 2007). High-throughput methods, particularly those based on analysis of the transcriptome, proved to be useful for understanding oncogenic processes in other tumor tissues, but few studies have been dedicated to the genomic profiling of MTC (Watanabe et al. 2002, Jain et al. 2004, Musholt et al. 2005). In order to explore genomic alterations associated with the development of both inherited and sporadic MTC, a series of MTC from patients carrying either a MEN2A mutation (RET634), a MEN2B mutation (RET918), or a sporadic MTC (RET918 and RETwt) were analyzed by microarrays. It is noteworthy that there are no benign tumors arising from C cells and that normal C cell or even hyperplasic C cell population represents only a small percentage of thyroid tissue cells, and for this reason, a normal thyroid tissue cannot be used as a representative reference for normal C cells. Moreover, MTC being a rare disease, it is difficult to gather a large sample collection for genomic study, thus data obtained by microarrays experiments were then analyzed by Q-PCR and immunohistochemistry on a larger series of MTC.

Cluster analysis of all samples discriminated between germline MTCs that resulted from either RET634 or RET918 mutation. Independently of their inherited or sporadic status, MTC bearing the RET918 mutation clusterized in the same group. Interestingly, sporadic RETwt MTC from patients with distant metastases segregated with RET918 MTC, whereas sporadic RETwt MTC from patients free of distant and cervical lymph node metastases were classified in the same group as RET634 MTC. This observation suggests that, in MTC, genomic profiling may distinguish aggressive from less aggressive tumors.

MTC bearing either the RET634 mutation or a sporadic RETWT showed overexpression of genes related to proliferation and cell survival, as compared with MTC bearing the RET918 mutation. Some of them are mediated by RET and GDNF family intracellular signaling, such as the IRS2 pathway (Hennige et al. 2000) leading to downstream factor activation of signal transducers and activators of a transcription, focal adhesion molecule (FAK), and Fyn, a Src-like kinase (Sariola & Saarma 2003, Panta et al. 2004, Plaza Menacho et al. 2005). Furthermore, vitronectin receptor integrin (ITGAV) and caveolin (CAV1), two factors involved in the FAK and Fyn stimulation pathways, leading to Ras/MAPK pathway activation and cell proliferation, were also found to be overexpressed (Wary et al. 1998, Panta et al. 2004, Plaza Menacho et al. 2005). This observation suggests that these molecules could be involved in tumor growth and progression; in agreement with a recent report showing that calcitonin stimulates prostate cancer cells through vitronectin receptor integrin signaling (Thomas et al. 2007).

The MTC group containing the more aggressive tumors was characterized by the upregulation of several genes, particularly the PTN and ESM1 genes. PTN gene, encoding pleiotrophin, a heparin-binding neurite outgrowth-promoting factor, is involved in mitogenic signaling. Its expression, through stimulation of the stromal cell microenvironment, accelerates tumor progression (Chang et al. 2007), stimulates angiogenesis, and predisposes to local spread and metastasis. Increased expression of PTN gene was reported in a variety of human tumors, and it has been suggested to be a potential target for new treatments (Klomp et al. 2002, Kadomatsu & Muramatsu 2004, Malerczyk et al. 2005). Pleiotrophin signaling increases tyrosine phosphorylation of beta beta-catenin (Meng et al. 2000). Interestingly, a novel mechanism of RET-mediated function highlights the role of increased phosphorylated β-catenin in the development and aggressivity of medullary thyroid cancer (Gujral et al. 2008). In this context, our observation showing that targeting RET with siRNA results in a rapid decrease in PTN gene expression would deserve further investigation.

Genes encoding for factors involved in matrix remodeling and cell adhesion, such as ESM1, COL1A1, COL1A2, CDH11, and FAP, were found to be up-regulated. COL1A1 and COL1A2 genes, as well as CEACAM6 gene, are overexpressed in the aggressive group, and were reported to be potentially involved in invasion and metastasis (Oue et al. 2004). Furthermore, COL1A2 and CEACAM6 have been previously reported in MEN2B patients and identified as overexpressed in an aggressive sporadic tumor (Jain et al. 2004). However, these results are not in agreement with those observed in a NIH 3T3 fibroblast model, transfected with RET mutants, and this discrepancy can be attributed to the in vivo versus in vitro design of the experiments (Watanabe et al. 2002, Jain et al. 2004). Interestingly, the KAZALD1 or BONO1 gene, encoding a molecule belonging to the IGFBP superfamily involved in the proliferation of osteoblasts during bone formation and regeneration (Shibata et al. 2004), was found to be one of the most up-regulated genes, particularly in one patient presenting skeletal abnormalities. These clinical features are encountered in some MEN2B patients and are characterized by the secretion of another developmental bone regulator, the chondromodulin-1 protein (Jain et al. 2004). It would be interesting to investigate how these two molecules are potentially involved in the skeletal changes observed in MEN2B patients. Finally, proopiomelanocortin, a precursor for several opioid peptides, including ACTH, lipotropin, endorphin, α- and β-MSH, was overexpressed at both gene and protein levels. It has been demonstrated that measuring POMC mRNA by in situ hybridization is very helpful in confirming MTC as the source of ectopic ACTH production (Smallridge et al. 2003). Cushing's syndrome, due to ectopic ACTH secretion, is rare in MTC and usually occurs in patients with aggressive disease and large metastases (Barbosa et al. 2005).

TT cell, a human MTC cell line bearing a RET634 mutation, showed gene expression attributes of both groups of tumors, as defined by the molecular signatures. This suggests that TT cells have acquired additional genetic alterations during in vitro growth, and display peculiar phenotypic and genetic features different from those present in the initial explanted tumor cells. Using this model for silencing the RET pathway indicated that CALCA, PTN, and GEM genes are likely to be regulated either directly or indirectly by the RET634 mutant.

Our results show that the oncogenic process in wild-type RET MTC can be close to that observed in mutated RET MTC. MTC with MEN2B RET mutation and aggressive MTC RET WT show gene expression related to invasion and metastasis pathways, further studies are needed to understand their mechanism of action in this pathology, to evaluate their use in diagnosis on fine needle aspiration biopsies or as prognostic markers and therapeutic targeting in MTC (Russo et al. 1999). The presence of genomic profiles typical of aggressive tumors, even in the absence of known RET mutations, when confirmed in larger series of samples, may allow the use of these genetic markers for the prognosis of RET-negative samples.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from CEA LRC-29V, Association pour la Recherche sur le Cancer, and Ligue contre le Cancer (Comité Val de Marne). Nabahet Ameur is a recipient from the French National Ligue contre le Cancer (2007).

Acknowledgements

We thank Didier Metivier at INSERM U848, Institut de Cancérologie Gustave-Roussy, for technical help.

References

  • BachelotALombardoFBaudinEBidartJMSchlumbergerM2002Inheritable forms of medullary thyroid carcinoma. Biochimie846166.

  • BallD2007Medullary thyroid cancer: monitoring and therapy. Endocrinology and Metabolism Clinics of North America36823837.

  • BarbosaSLRodienPLeboulleuxSNiccoli-SirePKraimpsJLCaronPArchambeaud-MouverouxFConte-DevolxBRohmerVGroupe d' Etude des Tumeurs Endocrines2005Ectopic adrenocorticotropic hormone-syndrome in medullary carcinoma of the thyroid: a retrospective analysis and review of the literature. Thyroid15618623.

    • Search Google Scholar
    • Export Citation
  • ChangYZukaMPerez-PineraPAstudilloAMortimerJBerensonJRDeuelTF2007Secretion of pleiotrophin stimulates breast cancer progression through remodelling of the tumor microenvironment. PNAS1041088810893.

    • Search Google Scholar
    • Export Citation
  • Donis-KellerHDouSChiDCarlsonKMToshimaKLairmoreTCHoweJRMoleyJFGoodfellowPWellsSA1993Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Human Molecular Genetics2851856.

    • Search Google Scholar
    • Export Citation
  • GujralTSvan VeelenWRichardsonDSMyersSMMeensJAActonDSDuñachMElliottBEHöppenerJWMulliganLM2008A novel RET kinase-beta-catenin signaling pathway contributes to tumorigenesis in thyroid carcinoma. Cancer Research6813381346.

    • Search Google Scholar
    • Export Citation
  • HennigeAMLammersRArltDHöppnerWStrackVNiederfellnerGSeifFJHäringHUKellererM2000Ret oncogene signal transduction via a IRS-2/PI 3-kinase/PKB and a SHC/Grb-2 dependent pathway: possible implication for transforming activity in NIH3T3 cells. Molecular and Cellular Endocrinology1676976.

    • Search Google Scholar
    • Export Citation
  • HoffAOHoffPM2007Medullary thyroid carcinoma. Hematology/Oncology Clinics of North America21475488.

  • JainSWatsonMADeBenedettiMKHirakiYMoleyJFMilbrandtJ2004Expression profiles provide insights into early malignant potential and skeletal abnormalities in multiple endocrine neoplasia type 2B syndrome tumors. Cancer Research6439073913.

    • Search Google Scholar
    • Export Citation
  • KadomatsuKMuramatsuT2004Midkine and pleiotrophin in neural development and cancer. Cancer Letters204127143.

  • KlompHJZernialOFlachmannSWellsteinAJuhlH2002Significance of the expression of the growth factor pleiotrophin in pancreatic cancer patients. Clinical Cancer Research8823827.

    • Search Google Scholar
    • Export Citation
  • KurokawaKKawaiKHashimotoMItoYTakahashiM2003Cell signalling and gene expression mediated by RET tyrosine kinase. Journal of Internal Medicine253627633.

    • Search Google Scholar
    • Export Citation
  • LacroixLLazarVMichielsSRipocheHDessenPTalbotMCaillouBLevillainJPSchlumbergerMBidartJM2005Follicular thyroid tumors with the PAX8-PPARgamma1 rearrangement display characteristic genetic alterations. American Journal of Pathology167223231.

    • Search Google Scholar
    • Export Citation
  • LeboulleuxSBaudinETravagliJPSchlumbergerM2004Medullary thyroid carcinoma. Clinical Endocrinology61299310.

  • MalerczykCSchulteAMCzubaykoFBellonLMacejakDRiegelATWellsteinA2005Ribozyme targeting of the growth factor pleiotrophin in established tumors: a gene therapy approach. Gene Therapy12339346.

    • Search Google Scholar
    • Export Citation
  • ManieSSantoroMFuscoABillaudM2001The RET receptor: function in development and dysfunction in congenital malformation. Trends in Genetics17580589.

    • Search Google Scholar
    • Export Citation
  • Matias-Guiu X DeLellis R Moley JF Gagel RF Albores-Saavedra J Bussolati G Kaserer K Williams ED & Baloch Z 2004 Medullary thyroid carcinoma. In Pathology and Genetics: Tumours of Endocrine Organs World Health Orgnization Classification of Tumours pp 86–91. Lyon: IARC Library.

  • MengKRodriguez-PeñaADimitrovTChenWYaminMNodaMDeuelTF2000Pleiotrophin signals increased tyrosine phosphorylation of beta beta-catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta/zeta. PNAS9726032608.

    • Search Google Scholar
    • Export Citation
  • MusholtTJHanackJBrehmCvon WasielewskiRMusholtPB2005Searching for non-RET molecular alterations in medullary thyroid carcinoma: expression analysis by mRNA differential display. World Journal of Surgery29472482.

    • Search Google Scholar
    • Export Citation
  • OueNHamaiYMitaniYMatsumuraSOshimoYAungPPKuraokaKNakayamaHYasuiW2004Gene expression profile of gastric carcinoma: identification of genes and tags potentially involved in invasion, metastasis, and carcinogenesis by serial analysis of gene expression. Cancer Research6423972405.

    • Search Google Scholar
    • Export Citation
  • PantaGRNwariakuFKimLT2004RET signals through focal adhesion kinase in medullary thyroid cancer cells. Surgery13612121217.

  • Plaza MenachoIKosterRvan der SlootAMQuaxWJOsingaJvan der SluisTHollemaHBurzynskiGMGimmOBuysCH2005RET-familial medullary thyroid carcinoma mutants Y791F and S891A activate a Src/JAK/STAT3 pathway, independent of glial cell line-derived neurotrophic factor. Cancer Research6517291737.

    • Search Google Scholar
    • Export Citation
  • PonderBA1999The phenotypes associated with ret mutations in the multiple endocrine neoplasia type 2 syndrome. Cancer Research591736s1741s.

    • Search Google Scholar
    • Export Citation
  • RussoDArturiFPontecorviAFilettiS1999Genetic analysis in fine-needle aspiration of the thyroid: a new tool for the clinic. Trends in Endocrinology and Metabolism10280285.

    • Search Google Scholar
    • Export Citation
  • SantoroMMelilloRMCarlomagnoFVecchioGFuscoA2004RET: normal and abnormal functions. Endocrinology14554485451.

  • SariolaHSaarmaM2003Novel functions and signalling pathways for GDNF. Journal of Cell Science11638553862.

  • SchlumbergerMCarlomagnoFBaudinEBidartJMSantoroM2008New therapeutic approaches to treat medullary thyroid carcinoma. Nature Clinical Practice. Endocrinology and Metabolism42232.

    • Search Google Scholar
    • Export Citation
  • ShibataYTsukazakiTHirataKXinCYamaguchiA2004Role of a new member of IGFBP superfamily, IGFBP-rP10, in proliferation and differentiation of osteoblastic cells. Biochemical and Biophysical Research Communications32511941200.

    • Search Google Scholar
    • Export Citation
  • SmallridgeRCBourneKPearsonBWVan HeerdenJACarpenterPCYoungWF2003Cushing's syndrome due to medullary thyroid carcinoma: diagnosis by proopiomelanocortin messenger ribonucleic acid in situ hybridization. Journal of Clinical Endocrinology and Metabolism8845654568.

    • Search Google Scholar
    • Export Citation
  • ThomasSChiriva-InternatiMShahGV2007Calcitonin receptor-stimulated migration of prostate cancer cells is mediated by urokinase receptor-integrin signaling. Clinical & Experimental Metastasis24363377.

    • Search Google Scholar
    • Export Citation
  • WaryKKMariottiAZurzoloCGiancottiFG1998A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell94625634.

    • Search Google Scholar
    • Export Citation
  • WatanabeTIchiharaMHashimotoMShimonoKShimoyamaYNagasakaTMurakumoYMurakamiHSugiuraHIwataH2002Characterization of gene expression induced by RET with MEN2A or MEN2B mutation. American Journal of Pathology161249256.

    • Search Google Scholar
    • Export Citation
  • ZabelMGrzeszkowiakJ1997Characterisation of thyroid medullary carcinoma TT cell line. Histology and Histopathology12283289.

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 735 571 7
PDF Downloads 188 157 7

Altmetrics

Figures

  • View in gallery

    Heat map representing the genes identified as differentially expressed between RET634/RET918 MTC in the 13 medullary thyroid carcinoma samples. The clustering of the 173 gene sequences is based on the RET634/RET918 set of genes determined by the ANOVA test, with criteria of fold change ≥2 and P value ≤10−3. Red or green color scales represent respectively up- and down-regulated genes in comparison with the reference. Each line corresponds to a gene and each column corresponds to a MTC sample (G634, tumors from patient with germline RET634 mutation; G918, tumors from patient with germline RET918 mutation; S918, tumors from patient with somatic RET918 mutation, SWT, tumors from patient without RET mutation).

  • View in gallery

    Validation of gene expression changes using quantitative PCR. Gene expression is measured by real-time quantitative PCR normalized with two housekeeping genes (RPLPO and 18S). G634 refers to tumor samples from patients with germline RET cysteine codon mutation (634, 611, or 6220); G918 refers to tumor samples from patients with germline RET918 mutation; S918 refers to tumor samples from patients with somatic RET918 mutation; SWT M1 refers to tumor samples from patients without RET mutation and with distant metastases; SWT M0 refers to tumor samples from patients without RET mutation and without distant metastases.

  • View in gallery

    Immunostaining of calcitonin, cyclin D1, pleiotrophin, ESM1, and proopiomelanocortin proteins in medullary thyroid carcinomas. A tissue microarray including 46 tissue samples was constructed as described in Materials and methods. Immunostaining is presented at magnification of (A) ×25 for a MTC sample (right) and its contralateral non-tumoral tissue (left), and (B) ×100 for the corresponding MTC sample. Calcitonin immunostaining in tumor cells was found to be cytoplasmic and heterogeneous; most of tumors cells were strongly stained and a subpopulation showed a weak staining. A strong positivity was observed for Cyclin D1 protein in the nuclei of tumor cells. A strong and heterogeneous cytoplasmic staining was observed with the pleiotrophin antibody, particularly on a subpopulation displaying an intense staining. Finally, ESM1 and proopiomelanocortin staining was located in the cytoplasm, showing a particular granular staining for proopiomelanocortin. No staining was detected in contralateral non-tumoral thyroid tissue.

  • View in gallery

    Gene expression analysis after RET siRNA treatment of TT cells. (A) Control, TT cells without siRNA transfection; siRNA control, TT cells transfected with siRNA control targeting a noncoding sequence; siRNA RET, TT cells transfected with siRNA targeting RET. (B) Cells were treated with siRNA RET and siRNA control at different times. Control without transfection was standardized to 1. At 96 h posttransfection, siRNA control treatment did not decrease gene expression and no effect was observed on ACTB and EPOR gene expression after siRNA RET treatment. RET transcript inhibition significantly decreased CALCA, PTN, and GEM gene expressions.

References

  • BachelotALombardoFBaudinEBidartJMSchlumbergerM2002Inheritable forms of medullary thyroid carcinoma. Biochimie846166.

  • BallD2007Medullary thyroid cancer: monitoring and therapy. Endocrinology and Metabolism Clinics of North America36823837.

  • BarbosaSLRodienPLeboulleuxSNiccoli-SirePKraimpsJLCaronPArchambeaud-MouverouxFConte-DevolxBRohmerVGroupe d' Etude des Tumeurs Endocrines2005Ectopic adrenocorticotropic hormone-syndrome in medullary carcinoma of the thyroid: a retrospective analysis and review of the literature. Thyroid15618623.

    • Search Google Scholar
    • Export Citation
  • ChangYZukaMPerez-PineraPAstudilloAMortimerJBerensonJRDeuelTF2007Secretion of pleiotrophin stimulates breast cancer progression through remodelling of the tumor microenvironment. PNAS1041088810893.

    • Search Google Scholar
    • Export Citation
  • Donis-KellerHDouSChiDCarlsonKMToshimaKLairmoreTCHoweJRMoleyJFGoodfellowPWellsSA1993Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Human Molecular Genetics2851856.

    • Search Google Scholar
    • Export Citation
  • GujralTSvan VeelenWRichardsonDSMyersSMMeensJAActonDSDuñachMElliottBEHöppenerJWMulliganLM2008A novel RET kinase-beta-catenin signaling pathway contributes to tumorigenesis in thyroid carcinoma. Cancer Research6813381346.

    • Search Google Scholar
    • Export Citation
  • HennigeAMLammersRArltDHöppnerWStrackVNiederfellnerGSeifFJHäringHUKellererM2000Ret oncogene signal transduction via a IRS-2/PI 3-kinase/PKB and a SHC/Grb-2 dependent pathway: possible implication for transforming activity in NIH3T3 cells. Molecular and Cellular Endocrinology1676976.

    • Search Google Scholar
    • Export Citation
  • HoffAOHoffPM2007Medullary thyroid carcinoma. Hematology/Oncology Clinics of North America21475488.

  • JainSWatsonMADeBenedettiMKHirakiYMoleyJFMilbrandtJ2004Expression profiles provide insights into early malignant potential and skeletal abnormalities in multiple endocrine neoplasia type 2B syndrome tumors. Cancer Research6439073913.

    • Search Google Scholar
    • Export Citation
  • KadomatsuKMuramatsuT2004Midkine and pleiotrophin in neural development and cancer. Cancer Letters204127143.

  • KlompHJZernialOFlachmannSWellsteinAJuhlH2002Significance of the expression of the growth factor pleiotrophin in pancreatic cancer patients. Clinical Cancer Research8823827.

    • Search Google Scholar
    • Export Citation
  • KurokawaKKawaiKHashimotoMItoYTakahashiM2003Cell signalling and gene expression mediated by RET tyrosine kinase. Journal of Internal Medicine253627633.

    • Search Google Scholar
    • Export Citation
  • LacroixLLazarVMichielsSRipocheHDessenPTalbotMCaillouBLevillainJPSchlumbergerMBidartJM2005Follicular thyroid tumors with the PAX8-PPARgamma1 rearrangement display characteristic genetic alterations. American Journal of Pathology167223231.

    • Search Google Scholar
    • Export Citation
  • LeboulleuxSBaudinETravagliJPSchlumbergerM2004Medullary thyroid carcinoma. Clinical Endocrinology61299310.

  • MalerczykCSchulteAMCzubaykoFBellonLMacejakDRiegelATWellsteinA2005Ribozyme targeting of the growth factor pleiotrophin in established tumors: a gene therapy approach. Gene Therapy12339346.

    • Search Google Scholar
    • Export Citation
  • ManieSSantoroMFuscoABillaudM2001The RET receptor: function in development and dysfunction in congenital malformation. Trends in Genetics17580589.

    • Search Google Scholar
    • Export Citation
  • Matias-Guiu X DeLellis R Moley JF Gagel RF Albores-Saavedra J Bussolati G Kaserer K Williams ED & Baloch Z 2004 Medullary thyroid carcinoma. In Pathology and Genetics: Tumours of Endocrine Organs World Health Orgnization Classification of Tumours pp 86–91. Lyon: IARC Library.

  • MengKRodriguez-PeñaADimitrovTChenWYaminMNodaMDeuelTF2000Pleiotrophin signals increased tyrosine phosphorylation of beta beta-catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta/zeta. PNAS9726032608.

    • Search Google Scholar
    • Export Citation
  • MusholtTJHanackJBrehmCvon WasielewskiRMusholtPB2005Searching for non-RET molecular alterations in medullary thyroid carcinoma: expression analysis by mRNA differential display. World Journal of Surgery29472482.

    • Search Google Scholar
    • Export Citation
  • OueNHamaiYMitaniYMatsumuraSOshimoYAungPPKuraokaKNakayamaHYasuiW2004Gene expression profile of gastric carcinoma: identification of genes and tags potentially involved in invasion, metastasis, and carcinogenesis by serial analysis of gene expression. Cancer Research6423972405.

    • Search Google Scholar
    • Export Citation
  • PantaGRNwariakuFKimLT2004RET signals through focal adhesion kinase in medullary thyroid cancer cells. Surgery13612121217.

  • Plaza MenachoIKosterRvan der SlootAMQuaxWJOsingaJvan der SluisTHollemaHBurzynskiGMGimmOBuysCH2005RET-familial medullary thyroid carcinoma mutants Y791F and S891A activate a Src/JAK/STAT3 pathway, independent of glial cell line-derived neurotrophic factor. Cancer Research6517291737.

    • Search Google Scholar
    • Export Citation
  • PonderBA1999The phenotypes associated with ret mutations in the multiple endocrine neoplasia type 2 syndrome. Cancer Research591736s1741s.

    • Search Google Scholar
    • Export Citation
  • RussoDArturiFPontecorviAFilettiS1999Genetic analysis in fine-needle aspiration of the thyroid: a new tool for the clinic. Trends in Endocrinology and Metabolism10280285.

    • Search Google Scholar
    • Export Citation
  • SantoroMMelilloRMCarlomagnoFVecchioGFuscoA2004RET: normal and abnormal functions. Endocrinology14554485451.

  • SariolaHSaarmaM2003Novel functions and signalling pathways for GDNF. Journal of Cell Science11638553862.

  • SchlumbergerMCarlomagnoFBaudinEBidartJMSantoroM2008New therapeutic approaches to treat medullary thyroid carcinoma. Nature Clinical Practice. Endocrinology and Metabolism42232.

    • Search Google Scholar
    • Export Citation
  • ShibataYTsukazakiTHirataKXinCYamaguchiA2004Role of a new member of IGFBP superfamily, IGFBP-rP10, in proliferation and differentiation of osteoblastic cells. Biochemical and Biophysical Research Communications32511941200.

    • Search Google Scholar
    • Export Citation
  • SmallridgeRCBourneKPearsonBWVan HeerdenJACarpenterPCYoungWF2003Cushing's syndrome due to medullary thyroid carcinoma: diagnosis by proopiomelanocortin messenger ribonucleic acid in situ hybridization. Journal of Clinical Endocrinology and Metabolism8845654568.

    • Search Google Scholar
    • Export Citation
  • ThomasSChiriva-InternatiMShahGV2007Calcitonin receptor-stimulated migration of prostate cancer cells is mediated by urokinase receptor-integrin signaling. Clinical & Experimental Metastasis24363377.

    • Search Google Scholar
    • Export Citation
  • WaryKKMariottiAZurzoloCGiancottiFG1998A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell94625634.

    • Search Google Scholar
    • Export Citation
  • WatanabeTIchiharaMHashimotoMShimonoKShimoyamaYNagasakaTMurakumoYMurakamiHSugiuraHIwataH2002Characterization of gene expression induced by RET with MEN2A or MEN2B mutation. American Journal of Pathology161249256.

    • Search Google Scholar
    • Export Citation
  • ZabelMGrzeszkowiakJ1997Characterisation of thyroid medullary carcinoma TT cell line. Histology and Histopathology12283289.

Cited By

PubMed

Google Scholar