Filter

Refine by collections

Refine by date

—

Refine by access

  • Print
  • Save

Search Results

You are looking at 1 - 10 of 96 items for :

  • Refine by access: All content x
Clear All
Audrey Ziverec Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France

Search for other papers by Audrey Ziverec in
Google Scholar
PubMed Close
,
Marie Chanal Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France

Search for other papers by Marie Chanal in
Google Scholar
PubMed Close
,
Perrine Raymond Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France

Search for other papers by Perrine Raymond in
Google Scholar
PubMed Close
,
Mirela Diana Ilie Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France
Endocrinology Department, “C.I. Parhon” National Institute of Endocrinology, Bucharest, Romania

Search for other papers by Mirela Diana Ilie in
Google Scholar
PubMed Close
,
Dario De Alcubierre Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France

Search for other papers by Dario De Alcubierre in
Google Scholar
PubMed Close
,
Arja Pasternack Department of Physiology, Faculty of Medicine, University of Helsinki, Helsinki, Finland

Search for other papers by Arja Pasternack in
Google Scholar
PubMed Close
,
Olli Ritvos Department of Physiology, Faculty of Medicine, University of Helsinki, Helsinki, Finland

Search for other papers by Olli Ritvos in
Google Scholar
PubMed Close
,
Gerald Raverot Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France
Faculté de Médecine Lyon Est, Université Lyon 1, Lyon, France
Department of Endocrinology, Reference center for rare pituitary disease (HYPO), Groupement Hospitalier EST, Hospices Civils de Lyon, University of Lyon, Lyon, France

Search for other papers by Gerald Raverot in
Google Scholar
PubMed Close
, and
Philippe Bertolino Cancer Research Centre of Lyon (CRCL), INSERM U1052, CNRS UMR5286, Claude Bernard University, Lyon, France

Search for other papers by Philippe Bertolino in
Google Scholar
PubMed Close

’-AGGACATAGGGGAGCAGTTTCAG-3’), Ki67 (Fw 5’-GCTGTCCTCAAGACAATCATCA-3’; Rev 5’-GGCGTTATCCCAGGAGACT-3’), Gdf9 (Fw 5’-CAACCAGGTGACAGGACCG-3’; Rev 5’-AGCAAGTGTTCCATGGCAGT-3’), Vegfa (Fw 5’-CTGCTCTCTTGGGTGCACTG-3’; Rev 5’-GCAGCCTGGGACCACTTG-3’), Vegfb (Fw 5

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-22-0245
Volume/Issue:
Volume 30: Issue 3
Restricted access
B Shan
Search for other papers by B Shan in
Google Scholar
PubMed Close
,
J Gerez Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by J Gerez in
Google Scholar
PubMed Close
,
M Haedo Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by M Haedo in
Google Scholar
PubMed Close
,
M Fuertes Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by M Fuertes in
Google Scholar
PubMed Close
,
M Theodoropoulou
Search for other papers by M Theodoropoulou in
Google Scholar
PubMed Close
,
M Buchfelder Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by M Buchfelder in
Google Scholar
PubMed Close
,
M Losa Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by M Losa in
Google Scholar
PubMed Close
,
G K Stalla
Search for other papers by G K Stalla in
Google Scholar
PubMed Close
,
E Arzt Neuroendocrinology Group, Laboratorio de Fisiología y Biología Molecular, Neurosurgical Clinic, Department of Neurosurgery, Max Planck Institute of Psychiatry, Kraepelinstrasse 10, D-80804 Munich, Germany

Search for other papers by E Arzt in
Google Scholar
PubMed Close
, and
U Renner
Search for other papers by U Renner in
Google Scholar
PubMed Close

. Further expanding tumours show cellular hypoxia which leads to a rise in HIF-1 protein expression leading to the production of angiogenic factors, such as vascular endothelial growth factor-A (VEGF-A), which is involved in the sprouting of new vessels into

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-11-0211
Volume/Issue:
Volume 19: Issue 1
Free access
Tsai-Der Chuang Department of Obstetrics and Gynecology, University of Florida, Gainesville, Florida 32610-0294, USA

Search for other papers by Tsai-Der Chuang in
Google Scholar
PubMed Close
,
Harekrushna Panda Department of Obstetrics and Gynecology, University of Florida, Gainesville, Florida 32610-0294, USA

Search for other papers by Harekrushna Panda in
Google Scholar
PubMed Close
,
Xiaoping Luo Department of Obstetrics and Gynecology, University of Florida, Gainesville, Florida 32610-0294, USA

Search for other papers by Xiaoping Luo in
Google Scholar
PubMed Close
, and
Nasser Chegini Department of Obstetrics and Gynecology, University of Florida, Gainesville, Florida 32610-0294, USA

Search for other papers by Nasser Chegini in
Google Scholar
PubMed Close

exposure. We confirmed ZEB 1/2 , validated VEGFA, FBLN5 , and TIMP2 as direct targets of miR-200c in MSMC, LSMC, and SKLM-S1, and showed that overexpression of miR-200c caused phenotypic modification of MSMC and LSMC, but not SKLM-S1, and inhibited

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-12-0007
Volume/Issue:
Volume 19: Issue 4
Open access
View license
N Garcia de la Torre
Search for other papers by N Garcia de la Torre in
Google Scholar
PubMed Close
,
I Buley
Search for other papers by I Buley in
Google Scholar
PubMed Close
,
J A H Wass
Search for other papers by J A H Wass in
Google Scholar
PubMed Close
, and
H E Turner
Search for other papers by H E Turner in
Google Scholar
PubMed Close

stimuli for angiogenesis has yielded numerous candidates including vascular endothelial growth factor A (VEGF-A), fibroblast growth factor-2 (FGF-2), transforming growth factor α (TGF-α), TGF-β, hepatocyte growth factor, tumour necrosis factor α

Article Type:
Research Article
DOI:
https://doi.org/10.1677/erc.1.01210
Volume/Issue:
Volume 13: Issue 3
Free access
Sonja Balthasar Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Sonja Balthasar in
Google Scholar
PubMed Close
,
Nina Bergelin Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland
Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Nina Bergelin in
Google Scholar
PubMed Close
,
Christoffer Löf Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Christoffer Löf in
Google Scholar
PubMed Close
,
Minna Vainio Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Minna Vainio in
Google Scholar
PubMed Close
,
Sture Andersson Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Sture Andersson in
Google Scholar
PubMed Close
, and
Kid Törnquist Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland
Department of Biology, Turku Graduate School of Biomedical Sciences, Laboratory of Animal Physiology, Hospital for Children and Adolescents, Minerva Foundation Institute for Medical Research, Åbo Akademi University, Tykistökatu 6A, 20520 Turku, Finland

Search for other papers by Kid Törnquist in
Google Scholar
PubMed Close

amounts of both VEGF-A and -C compared with FRO cells, but S1P stimulates VEGF-A secretion in both cell lines. We show that VEGFR-2 signalling is involved in S1P-induced Akt phosphorylation and migration of ML-1 cells. Furthermore, VEGFR-2 regulates S1P

Article Type:
Research Article
DOI:
https://doi.org/10.1677/ERC-07-0253
Volume/Issue:
Volume 15: Issue 2
Free access
Chiara Verdelli Laboratory of Experimental Endocrinology, IRCCS Istituto Ortopedico Galeazzi, Milan, Italy

Search for other papers by Chiara Verdelli in
Google Scholar
PubMed Close
,
Irene Forno Department of Pathophysiology and Organ Transplantation, University of Milan, Milan, Italy

Search for other papers by Irene Forno in
Google Scholar
PubMed Close
,
Annamaria Morotti Department of Pathophysiology and Organ Transplantation, University of Milan, Milan, Italy
Endocrine Surgery, IRCCS Ospedale San Raffaele, Milan, Italy

Search for other papers by Annamaria Morotti in
Google Scholar
PubMed Close
,
Riccardo Maggiore Endocrine Surgery, IRCCS Istituto Auxologico Italiano, Milan, Italy

Search for other papers by Riccardo Maggiore in
Google Scholar
PubMed Close
,
Gilberto Mari Endocrine Surgery, IRCCS Istituto Auxologico Italiano, Milan, Italy

Search for other papers by Gilberto Mari in
Google Scholar
PubMed Close
,
Leonardo Vicentini Division of Pathology, Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Milan, Italy

Search for other papers by Leonardo Vicentini in
Google Scholar
PubMed Close
,
Stefano Ferrero Endocrine Surgery, IRCCS Ospedale San Raffaele, Milan, Italy
Department of Biomedical, Surgical and Dental Sciences, University of Milan, Milan, Italy

Search for other papers by Stefano Ferrero in
Google Scholar
PubMed Close
,
Elisabetta Kuhn Endocrine Surgery, IRCCS Ospedale San Raffaele, Milan, Italy
Department of Biomedical, Surgical and Dental Sciences, University of Milan, Milan, Italy

Search for other papers by Elisabetta Kuhn in
Google Scholar
PubMed Close
,
Valentina Vaira Department of Pathophysiology and Organ Transplantation, University of Milan, Milan, Italy
Division of Pathology, Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Milan, Italy

Search for other papers by Valentina Vaira in
Google Scholar
PubMed Close
, and
Sabrina Corbetta Department of Biomedical, Surgical and Dental Sciences, University of Milan, Milan, Italy
Endocrinology and Diabetology Service, IRCCS Istituto Ortopedico Galeazzi, Milan, Italy

Search for other papers by Sabrina Corbetta in
Google Scholar
PubMed Close

expressed at the surface of endothelial cells. One well-known activator of angiogenesis is the secreted protein vascular endothelial growth factor A (VEGFA) ( Ferrara 2009 ). We previously demonstrated that the tumor-associated myofibroblasts (TAMs) are

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-20-0313
Volume/Issue:
Volume 28: Issue 1
Restricted access
Haleh Vosgha Cancer Molecular Pathology, School of Medicine, Menzies Health Institute Queensland, Griffith University, Gold Coast, Queensland, Australia

Search for other papers by Haleh Vosgha in
Google Scholar
PubMed Close
,
Armin Ariana Cancer Molecular Pathology, School of Medicine, Menzies Health Institute Queensland, Griffith University, Gold Coast, Queensland, Australia

Search for other papers by Armin Ariana in
Google Scholar
PubMed Close
,
Robert Anthony Smith Cancer Molecular Pathology, School of Medicine, Menzies Health Institute Queensland, Griffith University, Gold Coast, Queensland, Australia
Genomics Research Centre, Institute of Health and Biomedical Innovation, Faculty of Health, Queensland University of Technology, Brisbane, Queensland, Australia

Search for other papers by Robert Anthony Smith in
Google Scholar
PubMed Close
, and
Alfred King-yin Lam Cancer Molecular Pathology, School of Medicine, Menzies Health Institute Queensland, Griffith University, Gold Coast, Queensland, Australia

Search for other papers by Alfred King-yin Lam in
Google Scholar
PubMed Close

plays an important role in activating the proteins and pro-angiogenic factors involved ( Fig. 1 ). Vascular endothelial growth factor A ( VEGF-A ), above all other known pro-angiogenic factors, induces sprouting of new blood vessels. In thyroid

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-17-0497
Volume/Issue:
Volume 25: Issue 3
Free access
C Verdelli Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by C Verdelli in
Google Scholar
PubMed Close
,
L Avagliano Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by L Avagliano in
Google Scholar
PubMed Close
,
P Creo Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by P Creo in
Google Scholar
PubMed Close
,
V Guarnieri Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by V Guarnieri in
Google Scholar
PubMed Close
,
A Scillitani Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by A Scillitani in
Google Scholar
PubMed Close
,
L Vicentini Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by L Vicentini in
Google Scholar
PubMed Close
,
G B Steffano Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by G B Steffano in
Google Scholar
PubMed Close
,
E Beretta Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by E Beretta in
Google Scholar
PubMed Close
,
L Soldati Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by L Soldati in
Google Scholar
PubMed Close
,
E Costa Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by E Costa in
Google Scholar
PubMed Close
,
A Spada Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by A Spada in
Google Scholar
PubMed Close
,
G P Bulfamante Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by G P Bulfamante in
Google Scholar
PubMed Close
, and
S Corbetta Laboratory of Molecular Biology, Department of Human Pathology, Laboratory of Stem Cells for Tissue Engineering, Medical Genetics, Endocrinology Unit, Endocrine Surgery, Surgery Unit, Surgery Unit, Department of Health Sciences, Endocrinology and Diabetology Unit, Endocrinology and Diabetology Unit, IRCCS Policlinico San Donato, San Donato Milanese, Milan, Italy

Search for other papers by S Corbetta in
Google Scholar
PubMed Close

FAM dye-labelled (vascular endothelial growth factor A ( VEGFA ), Hs000900055_m1; α -SMA , Hs00426835_g1; PTH , Hs00757710_1g and CCND1 , Hs00765553_m1, Applied Biosystems, Life Technologies), 10 μl of 2× TaqMan Gene Expression MasterMix (Applied

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-14-0161
Volume/Issue:
Volume 22: Issue 1
Free access
Charline Dubois Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Charline Dubois in
Google Scholar
PubMed Close
,
Natacha Rocks Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Natacha Rocks in
Google Scholar
PubMed Close
,
Silvia Blacher Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Silvia Blacher in
Google Scholar
PubMed Close
,
Irina Primac Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Irina Primac in
Google Scholar
PubMed Close
,
Anne Gallez Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Anne Gallez in
Google Scholar
PubMed Close
,
Melissa García-Caballero Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Melissa García-Caballero in
Google Scholar
PubMed Close
,
Céline Gérard Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Céline Gérard in
Google Scholar
PubMed Close
,
Laurent Brouchet Thoracic Surgery Department, University Hospital CHU Toulouse, Toulouse, France

Search for other papers by Laurent Brouchet in
Google Scholar
PubMed Close
,
Agnès Noël Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Agnès Noël in
Google Scholar
PubMed Close
,
Françoise Lenfant INSERM UMR1048, Institut des Maladies Métaboliques et Cardiovasculaires – I2MC, University of Toulouse III Paul Sabatier, UPS, Toulouse, France

Search for other papers by Françoise Lenfant in
Google Scholar
PubMed Close
,
Didier Cataldo Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Didier Cataldo in
Google Scholar
PubMed Close
, and
Christel Pequeux Laboratory of Tumour and Development Biology, GIGA-Cancer, University of Liège, CHU-B23, Liège, Belgium

Search for other papers by Christel Pequeux in
Google Scholar
PubMed Close

, when OVX females were used, E2 treatment increased tumour-related blood vessel network, while no modulation was observed in males. VEGFC, VEGFD, VEGFA and bFGF, the main prolymphangiogenic and proangiogenic factors, were measured by Milliplex assay in

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-18-0328
Volume/Issue:
Volume 26: Issue 2
Free access
Zara Zelenko Division of Endocrinology, Diabetes and Bone Diseases, Icahn School of Medicine at Mount Sinai, New York, New York, USA

Search for other papers by Zara Zelenko in
Google Scholar
PubMed Close
,
Emily Jane Gallagher Division of Endocrinology, Diabetes and Bone Diseases, Icahn School of Medicine at Mount Sinai, New York, New York, USA

Search for other papers by Emily Jane Gallagher in
Google Scholar
PubMed Close
,
Irini Markella Antoniou Division of Endocrinology, Diabetes and Bone Diseases, Icahn School of Medicine at Mount Sinai, New York, New York, USA

Search for other papers by Irini Markella Antoniou in
Google Scholar
PubMed Close
,
Deepali Sachdev Department of Medicine and Masonic Cancer Center, University of Minnesota, Minneapolis, Minnesota, USA

Search for other papers by Deepali Sachdev in
Google Scholar
PubMed Close
,
Anupma Nayak Department of Pathology and Laboratory Medicine, The Mount Sinai Hospital and Icahn School of Medicine at Mount Sinai, New York, New York, USA

Search for other papers by Anupma Nayak in
Google Scholar
PubMed Close
,
Douglas Yee Department of Medicine and Masonic Cancer Center, University of Minnesota, Minneapolis, Minnesota, USA

Search for other papers by Douglas Yee in
Google Scholar
PubMed Close
, and
Derek LeRoith Division of Endocrinology, Diabetes and Bone Diseases, Icahn School of Medicine at Mount Sinai, New York, New York, USA

Search for other papers by Derek LeRoith in
Google Scholar
PubMed Close

′CAGAGGATGACCTGCCAACA; 3′GCCCTTCCTTTCCTGTGTCAT. SLUG primers: 5′TTTCTGGGCTGGCCAAACAT; 3′TTCTCCCCCGTGTGAGTTCTA. TWIST1 primers: 5′GCCGGAGACCTAGATGTCATT; 3′CCCACGCCCTGTTTCTTTGA. VEGFA primers: 5′AGGCCAGCACATAGGAGAGA; 3′TTTCTTGCGCTTTCGTTTTT. VEGFD primers: 5

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-16-0142
Volume/Issue:
Volume 23: Issue 9
Free access