Filter

Refine by collections

Refine by date

—

Refine by access

  • Print
  • Save

Search Results

You are looking at 1 - 10 of 294 items for :

  • Refine by access: All content x
Clear All
Kristen Wong Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Kristen Wong in
Google Scholar
PubMed Close
,
Francesca Di Cristofano Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Francesca Di Cristofano in
Google Scholar
PubMed Close
,
Michela Ranieri Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Michela Ranieri in
Google Scholar
PubMed Close
,
Daniela De Martino Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Daniela De Martino in
Google Scholar
PubMed Close
, and
Antonio Di Cristofano Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Antonio Di Cristofano in
Google Scholar
PubMed Close

the cell cycle into the S phase is controlled by complexes formed by D-type cyclins and the CDK4 and CDK6 kinases, which phosphorylate and inactivate the RB tumor suppressor. In turn, RB inactivation releases the E2F transcription factors to promote

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-19-0011
Volume/Issue:
Volume 26: Issue 4
Free access
Neil Portman The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, New South Wales, Australia
St. Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, Australia

Search for other papers by Neil Portman in
Google Scholar
PubMed Close
,
Sarah Alexandrou The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, New South Wales, Australia
St. Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, Australia

Search for other papers by Sarah Alexandrou in
Google Scholar
PubMed Close
,
Emma Carson The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, New South Wales, Australia
St. Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, Australia

Search for other papers by Emma Carson in
Google Scholar
PubMed Close
,
Shudong Wang Centre for Drug Discovery and Development, Cancer Research Institute, University of South Australia, Adelaide, South Australia, Australia

Search for other papers by Shudong Wang in
Google Scholar
PubMed Close
,
Elgene Lim The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, New South Wales, Australia
St. Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, Australia

Search for other papers by Elgene Lim in
Google Scholar
PubMed Close
, and
C Elizabeth Caldon The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, New South Wales, Australia
St. Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, Australia

Search for other papers by C Elizabeth Caldon in
Google Scholar
PubMed Close

controlled by the retinoblastoma (Rb) protein. Rb restricts progression from G 1 phase into S phase by binding and suppressing E2F transcription factors. This is overcome by cyclin-dependent kinase 4/6 (CDK4/6) phosphorylation of the Rb protein, which leads

Article Type:
Review Article
DOI:
https://doi.org/10.1530/ERC-18-0317
Volume/Issue:
Volume 26: Issue 1
Free access
Thomas Yang Sun Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA

Search for other papers by Thomas Yang Sun in
Google Scholar
PubMed Close
,
Lan Zhao Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA

Search for other papers by Lan Zhao in
Google Scholar
PubMed Close
,
Paul Van Hummelen Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA

Search for other papers by Paul Van Hummelen in
Google Scholar
PubMed Close
,
Brock Martin Department of Pathology, Stanford University School of Medicine, Stanford, California, USA

Search for other papers by Brock Martin in
Google Scholar
PubMed Close
,
Kathleen Hornbacker Clinical Trials Office, Stanford University, Stanford, California, USA

Search for other papers by Kathleen Hornbacker in
Google Scholar
PubMed Close
,
HoJoon Lee Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA

Search for other papers by HoJoon Lee in
Google Scholar
PubMed Close
,
Li C Xia Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA
Division of Biostatistics, Department of Epidemiology and Public Health, Albert Einstein College of Medicine, Bronx, New York, USA

Search for other papers by Li C Xia in
Google Scholar
PubMed Close
,
Sukhmani K Padda Cedars-Sinai Medical Center, Department of Medical Oncology, Los Angeles, California, USA

Search for other papers by Sukhmani K Padda in
Google Scholar
PubMed Close
,
Hanlee P Ji Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, California, USA
Stanford Genome Technology Center, Stanford, California, USA

Search for other papers by Hanlee P Ji in
Google Scholar
PubMed Close
, and
Pamela Kunz Yale School of Medicine, Smilow Cancer Hospital, Yale Cancer Center, New Haven, Connecticut, USA

Search for other papers by Pamela Kunz in
Google Scholar
PubMed Close

organs with paired clinical outcome data. Our analysis revealed that G3 NENs had gene expression profiles that did not easily segregate by organ, that they shared mutations in TP53 , RB1 , APC , CDKN2A , and in the CDK4/6 cell cycling pathway, and

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-22-0015
Volume/Issue:
Volume 29: Issue 12
Restricted access
Meilin Zhang Department of Burn and Plastic Surgery, Chaoyang Central Hospital, Chaoyang, Liaoning Province, China

Search for other papers by Meilin Zhang in
Google Scholar
PubMed Close
,
Jian Song Department of Breast Surgery, the First Hospital of China Medical University, Shenyang, Liaoning Province, China

Search for other papers by Jian Song in
Google Scholar
PubMed Close
,
Shigang Guo Department of General Surgery, Chaoyang Central Hospital, Chaoyang, Liaoning Province, China

Search for other papers by Shigang Guo in
Google Scholar
PubMed Close
,
Feng Jin Department of Breast Surgery, the First Hospital of China Medical University, Shenyang, Liaoning Province, China

Search for other papers by Feng Jin in
Google Scholar
PubMed Close
, and
Ang Zheng Department of Breast Surgery, the First Hospital of China Medical University, Shenyang, Liaoning Province, China

Search for other papers by Ang Zheng in
Google Scholar
PubMed Close

). In recent years, with the continuous innovation of therapies, the emergence of cyclin-dependent kinase 4 and 6 (CDK4/6) inhibitors has brought new therapeutic directions for HR+, HER2− breast cancer. Globally marketed CDK4/6 inhibitors include

Article Type:
Review Article
DOI:
https://doi.org/10.1530/ERC-22-0365
Volume/Issue:
Volume 30: Issue 8
Free access
H H Milioli Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales, Australia
St Vincent’s Clinical School, UNSW Sydney, Sydney, New South Wales, Australia

Search for other papers by H H Milioli in
Google Scholar
PubMed Close
,
S Alexandrou Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales, Australia

Search for other papers by S Alexandrou in
Google Scholar
PubMed Close
,
E Lim Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales, Australia
St Vincent’s Clinical School, UNSW Sydney, Sydney, New South Wales, Australia

Search for other papers by E Lim in
Google Scholar
PubMed Close
, and
C E Caldon Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales, Australia
St Vincent’s Clinical School, UNSW Sydney, Sydney, New South Wales, Australia

Search for other papers by C E Caldon in
Google Scholar
PubMed Close

inhibits progression into S phase. During G 1 /S phase, cyclin dependent kinases (CDKs) phosphorylate Rb; first CDK4/6 is activated by cyclin D1, D2, or D3 to phosphorylate Rb, followed by phosphorylation by CDK2 in complex with cyclin E1 or cyclin E2

Article Type:
Review Article
DOI:
https://doi.org/10.1530/ERC-19-0501
Volume/Issue:
Volume 27: Issue 5
Free access
Carol A Lange Departments of Medicine and Pharmacology, Masonic Cancer Center, University of Minnesota, 420 Delaware Street South East, MMC 806, Minneapolis Minnesota 55455, USA

Search for other papers by Carol A Lange in
Google Scholar
PubMed Close
and
Douglas Yee Departments of Medicine and Pharmacology, Masonic Cancer Center, University of Minnesota, 420 Delaware Street South East, MMC 806, Minneapolis Minnesota 55455, USA

Search for other papers by Douglas Yee in
Google Scholar
PubMed Close

-dependent protein kinases four and six (CDK4/6) important for mediating phospho-RB-induced cell cycle progression at the G1/S boundary or ‘checkpoint’ ( Fig. 1 ). Other well-characterized functions of D-type cyclins include sequestration of cell cycle inhibitors (p

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-11-0112
Volume/Issue:
Volume 18: Issue 4
Free access
Thomas Ho Lai Yau School of Medicine, University of Nottingham, Derby, UK

Search for other papers by Thomas Ho Lai Yau in
Google Scholar
PubMed Close
and
Kwok-Leung Cheung School of Medicine, University of Nottingham, Derby, UK

Search for other papers by Kwok-Leung Cheung in
Google Scholar
PubMed Close

kinase 4/6 (CDK4/6) Inhibit Palbociclib, ribociclib Tyrosine kinase inhibitor (TKI) Inhibit Dovitinib An ever-growing arsenal of anticancer agents requires knowledge in optimal application for clinicians and patients to make

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-18-0021
Volume/Issue:
Volume 25: Issue 7
Free access
Shuk-Mei Ho Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
Cincinnati Cancer Center, Cincinnati, Ohio, USA
Cincinnati Veteran Affairs Hospital Medical Center, Cincinnati, Ohio, USA

Search for other papers by Shuk-Mei Ho in
Google Scholar
PubMed Close
,
Rahul Rao Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA

Search for other papers by Rahul Rao in
Google Scholar
PubMed Close
,
Sarah To Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
Center for Cancer Research, Hudson Institute of Medical Research, Clayton, Victoria, Australia
Monash University, Clayton, Victoria, Australia

Search for other papers by Sarah To in
Google Scholar
PubMed Close
,
Emma Schoch Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA

Search for other papers by Emma Schoch in
Google Scholar
PubMed Close
, and
Pheruza Tarapore Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA
Cincinnati Cancer Center, Cincinnati, Ohio, USA

Search for other papers by Pheruza Tarapore in
Google Scholar
PubMed Close

CDK4 hu-CDK4-F CTTCTGCAGTCCACATATGCAACA hu-CDK4-R CAACTGGTCGGCTTCAGAGTTTC CDK6 hu-CDK6-F TGGTGACCAGCAGCGGACAA hu-CDK6-R ACCACAGCGTGACGACCACT CDK2 hu-CDK2-F CCAGGAGTTACTTCTATGCCTGA hu-CDK2-R

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-16-0175
Volume/Issue:
Volume 24: Issue 2
Free access
Alexander Gorshtein Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Alexander Gorshtein in
Google Scholar
PubMed Close
,
Hadara Rubinfeld Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Hadara Rubinfeld in
Google Scholar
PubMed Close
,
Efrat Kendler Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Efrat Kendler in
Google Scholar
PubMed Close
,
Marily Theodoropoulou Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Marily Theodoropoulou in
Google Scholar
PubMed Close
,
Vesna Cerovac Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Vesna Cerovac in
Google Scholar
PubMed Close
,
Günter K Stalla Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Günter K Stalla in
Google Scholar
PubMed Close
,
Zvi R Cohen Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Zvi R Cohen in
Google Scholar
PubMed Close
,
Moshe Hadani Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Moshe Hadani in
Google Scholar
PubMed Close
, and
Ilan Shimon Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel
Institute of Endocrinology and Metabolism and Felsenstein Medical Research Center, Sackler School of Medicine, Department of Internal Medicine E, Department of Endocrinology, Department of Neurosurgery, Rabin Medical Center, Beilinson Campus, Petach Tikva 49100, Israel

Search for other papers by Ilan Shimon in
Google Scholar
PubMed Close

triggered by the activation of cyclin-dependent kinase (cdk) 4 and 6, by the D-type cyclins (cyclin D1–3) ( Sherr & Roberts 1995 ). Activated cdk4 and 6 phosphorylate retinoblastoma (Rb), which becomes inactivated and releases E2F factors ( Weinberg 1995

Article Type:
Research Article
DOI:
https://doi.org/10.1677/ERC-08-0269
Volume/Issue:
Volume 16: Issue 3
Free access
Jeong Won Park Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr, Room 5128, Bethesda, Maryland 20892-6264, USA

Search for other papers by Jeong Won Park in
Google Scholar
PubMed Close
,
Cho Rong Han Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr, Room 5128, Bethesda, Maryland 20892-6264, USA

Search for other papers by Cho Rong Han in
Google Scholar
PubMed Close
,
Li Zhao Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr, Room 5128, Bethesda, Maryland 20892-6264, USA

Search for other papers by Li Zhao in
Google Scholar
PubMed Close
,
Mark C Willingham Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr, Room 5128, Bethesda, Maryland 20892-6264, USA

Search for other papers by Mark C Willingham in
Google Scholar
PubMed Close
, and
Sheue-yann Cheng Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr, Room 5128, Bethesda, Maryland 20892-6264, USA

Search for other papers by Sheue-yann Cheng in
Google Scholar
PubMed Close

membrane (Immobilon-P; Millipore Corp., Billeria, MA, USA). The antibodies phosphorylated Rb (p-Rb, S780, 1:500 dilution), total-Rb (1:1000 dilution), Cdk4 (1:1000 dilution), Cdk6 (1:1000 dilution), p-Jak2 (Y1007/1008, 1:500 dilution), total-Jak2 (1

Article Type:
Research Article
DOI:
https://doi.org/10.1530/ERC-15-0417
Volume/Issue:
Volume 23: Issue 1
Free access