Dysregulation of secretion of CXC α-chemokine CXCL10 in papillary thyroid cancer: modulation by peroxisome proliferator-activated receptor-γ agonists

in Endocrine-Related Cancer

In papillary thyroid carcinomas (PTCs), oncogenes activate a transcriptional program including the upregulation of CXCL10 chemokine, which stimulates proliferation and invasion. Furthermore, peroxisome proliferator-activated receptor-γ (PPARγ) activators thiazolidinediones (TZDs) modulate CXCL10 secretion in normal thyroid follicular cells (TFC), and inhibit PTC growth. Until now, no study has evaluated the effect of cytokines on CXCL10 secretion in PTCs, nor the effect of PPARγ activation. The combined effects of interferon γ (IFNγ) and tumor necrosis factor α (TNFα) stimulation on CXCL10 secretion in primary cells from PTCs and TFC were tested. Furthermore, the effect of PPARγ activation by TZDs, on CXCL10 secretion and proliferation in these cell types was studied. In primary cultures of TFC and PTCs CXCL10 production was absent under basal conditions; a similar dose-dependent secretion of CXCL10 was induced by IFNγ in both cell types. TNFα alone induced a slight but significant CXCL10 secretion only in PTCs. The stimulation with IFNγ+TNFα induced a synergistic CXCL10 release in both cell types; however, a secretion more than ten times higher was induced in PTCs. Treatment of TFC with TZDs dose-dependently suppressed IFNγ+TNFα-induced CXCL10 release, while TZDs stimulated CXCL10 secretion in PTCs. A significant antiproliferative effect by TZDs was observed only in PTCs. In conclusion, a dysregulation of CXCL10 secretion has been shown in PTCs. In fact, a CXCL10 secretion more than ten times higher has been induced by IFNγ+TNFα in PTCs with respect to TFC. Moreover, TZDs inhibited CXCL10 secretion in TFC and stimulated it in PTCs. The effect of TZDs on CXCL10 was unrelated to the significant antiproliferative effect in PTCs.

Abstract

In papillary thyroid carcinomas (PTCs), oncogenes activate a transcriptional program including the upregulation of CXCL10 chemokine, which stimulates proliferation and invasion. Furthermore, peroxisome proliferator-activated receptor-γ (PPARγ) activators thiazolidinediones (TZDs) modulate CXCL10 secretion in normal thyroid follicular cells (TFC), and inhibit PTC growth. Until now, no study has evaluated the effect of cytokines on CXCL10 secretion in PTCs, nor the effect of PPARγ activation. The combined effects of interferon γ (IFNγ) and tumor necrosis factor α (TNFα) stimulation on CXCL10 secretion in primary cells from PTCs and TFC were tested. Furthermore, the effect of PPARγ activation by TZDs, on CXCL10 secretion and proliferation in these cell types was studied. In primary cultures of TFC and PTCs CXCL10 production was absent under basal conditions; a similar dose-dependent secretion of CXCL10 was induced by IFNγ in both cell types. TNFα alone induced a slight but significant CXCL10 secretion only in PTCs. The stimulation with IFNγ+TNFα induced a synergistic CXCL10 release in both cell types; however, a secretion more than ten times higher was induced in PTCs. Treatment of TFC with TZDs dose-dependently suppressed IFNγ+TNFα-induced CXCL10 release, while TZDs stimulated CXCL10 secretion in PTCs. A significant antiproliferative effect by TZDs was observed only in PTCs. In conclusion, a dysregulation of CXCL10 secretion has been shown in PTCs. In fact, a CXCL10 secretion more than ten times higher has been induced by IFNγ+TNFα in PTCs with respect to TFC. Moreover, TZDs inhibited CXCL10 secretion in TFC and stimulated it in PTCs. The effect of TZDs on CXCL10 was unrelated to the significant antiproliferative effect in PTCs.

Keywords:

Introduction

Chemokines are chemoattractant cytokines that regulate the trafficking and activation of leukocytes and other cell types under a variety of inflammatory and noninflammatory conditions (Luster 1998).

Over the past few years, studies have increasingly shown that chemokines play an important role in several aspects of tumor progression. Tumor cells express functional chemokine receptors, which can sustain proliferation, angiogenesis and survival, and promote organ-specific localization of distant metastases. Chemokine expression in human malignancies is associated with a leukocyte infiltration favoring the establishment of immune escape mechanisms. Relevant studies on preclinical testing of cancer therapies based on interference with the cancer chemokine network have been published (Ruffini et al. 2007).

CXC chemokines lacking the N-terminal ELR motif, such as interferon γ (IFNγ)-inducible protein 10 (IP-10/CXCL10), monokine induced by IFNγ (Mig/CXCL9) and IFNγ inducible T cell α-chemoattractant (ITAC/CXCL11), do not act as chemoattractants for neutrophils (Dewald et al. 1992, Loetscher et al. 1996, Mackay 1996), but attract activated T cells (Taub et al. 1993, Mackay 1996).

In the last few years, experimental evidence has accumulated supporting the concept that IFNγ-inducible chemokines (CXCL9, CXCL10 and CXCL11) and their receptor, CXCR3, play an important role in the initial stage of autoimmune disorders involving endocrine glands (Garcià-Lòpez et al. 2001, Romagnani et al. 2002, Kemp et al. 2003, Antonelli et al. 2004, 2005). The fact that, after IFNγ stimulation, endocrine epithelial cells secrete CXCL10, which is able to induce the chemotaxis of type 1 T helper lymphocytes, that in turn secrete IFNγ, thus perpetuating the autoimmune process, strongly supports the concept that chemokines play an important role in endocrine autoimmunity (Antonelli et al. 2006).

In papillary thyroid carcinomas (PTCs), rearrangements of the RET receptor (RET/PTC) and activating mutations in the BRAF or RAS oncogenes lead to the upregulation of the CXCL10 chemokine, which in turn stimulates proliferation and invasion (Melillo et al. 2005). Other studies have obtained similar results (Puxeddu et al. 2005).

Furthermore, it has been shown recently that high basal levels of Toll-like receptor 3 (TLR3) and noncanonical WNT5a RNA are present in PTCs cell lines consistent with their overexpression and colocalization in PTC cells in vivo, and that the basally expressed TLR3 are functional in PTC cells, as evidenced by the ability of double-strand RNA (polyinosine–polycytidylic acid) to increase significantly the levels of the end product of TLR3 signaling CXCL10 (McCall et al. 2007).

Recently, the presence of peroxisome proliferator-activated receptor-γ (PPARγ) has been demonstrated in thyroid tissue, and PPARγ has been shown to be involved in the modulation of inflammatory responses (Antonelli et al. 2006). In fact, the treatment of normal thyroid follicular cells (TFC) with a pure PPARγ activator, rosiglitazone (RGZ), at near-therapeutical doses, significantly inhibited IFNγ-stimulated CXCL10 secretion, strongly suggesting that PPARγ might be involved in the regulation of IFNγ-induced chemokine expression in human thyroid autoimmunity (Antonelli et al. 2006).

Moreover, PPARγ expression appears important in thyroid cancerogenesis and tumor progression, in fact PPARγ is considered a tumor suppressor gene. In follicular thyroid carcinomas, the PAX8/PPARγ fusion oncogene appears to suppress the activity of the wild-type gene (Kroll et al. 2000). The antitumor effect of PPARγ agonists is probably due to transactivating genes that regulate cell proliferation, apoptosis and differentiation. Agonists of PPARγ had an antiproliferative action in six cell lines, originated from patients with papillary thyroid cancer which expressed PPARγ, inducing apoptosis (Ohta et al. 2001), significantly inhibited tumor growth and prevented distant metastasis of thyroid cancer in nude mice. Furthermore, it has been shown that troglitazone significantly inhibited cell growth by cell cycle arrest and apoptotic cell death (Park et al. 2005). More recently, we have shown in primary cultured human anaplastic and papillary dedifferentiated thyroid cancers cells the antiproliferative effect of PPARγ agonists thiazolidinediones (TZDs; Antonelli et al. 2008a,b).

Until now, to our knowledge, no data are present in the literature about the regulation by IFNγ and tumor necrosis factor α (TNFα) of CXCL10 secretion in PTC, nor of PPARγ activators effect on these chemokines.

The aims of this study were firstly, to test the effect of IFNγ stimulation on the secretion of the CXC α-chemokine CXCL10 in primary cultures of cells obtained from PTC thyrocytes, in comparison with normal thyroid tissue; and secondly, to assess the effect of PPARγ activation on CXCL10 secretion in these cell types, correlating this effect to the antiproliferative effect of PPARγ activators.

Materials and methods

Patients source for thyroid tissue

Surgical thyroid tissue were obtained from six patients with PTC at the time of surgery. In addition, normal thyroid tissue was obtained from six patients (four undergoing parathyroidectomy, two to laryngeal intervention). The diagnosis was established on commonly accepted clinical, laboratory, and histological criteria. Immunohistochemistry showed the presence of expression of TSH receptor, thyroperoxidase, thyroglobulin and sodium/iodide symporter.

The study subjects gave their informed consent to the study, which was approved by the local ethical committee.

Microdissection and DNA extraction were performed using conventional methods previously described (Antonelli et al. 2008a, 2009).

Detection of BRAF mutation by PCR single strand conformation polymorphism and direct DNA sequencing were performed using conventional methods previously described (Antonelli et al. 2008a, 2009).

Thyroid follicular cells

Thyrocytes were prepared as previously reported (Garcià-Lòpez et al. 2001, Antonelli et al. 2006). The specimens were minced with scissors and digested by collagenase (1 mg/ml; Roche) in RPMI 1640 (Whittaker Bioproducts, Inc., Walkersville, MD, USA) for 1 h at 37 °C. Semi-digested follicles were removed, sedimented for 2 min, washed, and cultured in RPMI 1640 medium supplemented with 10% v/v FBS (fetal bovine serum; Seromed, Biochrom, Berlin, Germany), 2 mM glutamine, and 50 μg/ml penicillin/streptomycin at 37 °C and 5% CO2 in plastic 75 cm2 flasks (Sarstedt, Verona, Italy).

CXCL10 secretion assays

For CXCL10 secretion assays, 3000 cells were seeded onto 96-well plates in growth medium. After 24 h, the growth medium was removed, cells were accurately washed in PBS, and incubated in phenol red and serum-free medium. Cells were incubated (24 h) with IFNγ (R&D Systems, Minneapolis, MN, USA; 500, 1000, 5000, 10 000 U/ml) and 10 ng/ml TNFα (R&D Systems), alone or in combination. The concentration of TNFα was selected in preliminary experiments to yield the highest responses. After 24 h, the supernatant was removed and kept frozen at −20 °C until CXCL10 assay.

To investigate the effect of PPARγ activators on IFNγ-induced chemokine secretion, cells were stimulated (24 h) with IFNγ (1000 U/ml) and TNFα (10 ng/ml) in the absence or presence of increasing concentrations (0, 1, 10, 20 μmol/l) of the pure PPARγ agonists, RGZ (Glaxo, Welwyn, UK), or pioglitazone (Alexis Biochemicals, Lausen, Switzerland), and conditioned medium were assayed by ELISA for CXCL10 concentrations. All experiments were repeated three times with the different cell preparations.

Cell cultures and TZDs treatment

Cultures of thyrocytes were treated (24 h) with 10 or 20 μmol/l, RGZ or pioglitazone. Control cultures were grown (24 h) in the same medium containing vehicle (absolute ethanol, 0.47% v/v) without RGZ, or pioglitazone. Some cultures were examined by phase contrast microscopy using an Olympus IX50.

For quantitation of total protein in cell preparations, lysis and homogenization were performed and the sample was immediately assayed for its protein concentration by conventional methods.

Cell viability test

The number of viable cells was evaluated by a viability and proliferation assay, based on the cleavage of tetrazolium salts added to the culture medium (Cell Proliferation Reagent WST-1; Roche; Antonelli et al. 2008a,b,c, 2009).

The tetrazolium salts are cleaved to formazan by cellular enzymes. An expansion in the number of viable cells results in an increase in the overall activity of mitochondrial dehydrogenases in the sample, which leads to an increase in the amount of formazan dye formed, that directly correlates to the number of metabolically active cells in the culture (Antonelli et al. 2008a,b,c, 2009). The formazan dye produced by metabolically active cells was quantified by a scanning multiwell spectrophotometer (ELISA reader) by measuring the absorbance of the dye solution at 450 nm. Cells were seeded in a 96 wells microtiter plate at a concentration of 35 000 cells/ml in a final volume of 100 μl in each well. Then, they were incubated for 48 h with PPARγ activators, in a humidified atmosphere (37 °C, 5% CO2).

After the incubation period, 10 μl of the Cell Proliferation Reagent WST-1 were added to 100 μl of culture medium in each well and the absorbance of the samples was measured at 450 nm against the control (the same cells without any treatment) using a microtiter plate (ELISA) reader. The same volume of culture medium and Cell Proliferation Reagent WST-1 (10 μl of Cell Proliferation Reagent WST-1/100 μl of culture medium) was added into one well, in order to use this background control (absorbance of culture medium plus WST-1 in the absence of cells) as a blank position for the ELISA reader.

The absorbance was measured again after 1 and 2 h.

The measured absorbance of blank was subtracted from control and treatments and the control was normalized to 100% for each assay; treatments were expressed as % of the control.

The experiments were conducted in triplicate for each sample.

Proliferation assay: cell counting

Since MTT assay [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] measures mitochondrial cell activity and it has already been demonstrated that there is not always a direct relationship with cell number, the proliferation was evaluated using cell number counting (Gutiérrez-Cañas et al. 2003), as well. Cells were seeded at a density of 13 000 cells per well in 24-well tissue culture plates in medium supplemented with 10% v/v FBS with or without the indicated factors (Antonelli et al. 2008a,b,c, 2009).

The medium was changed every other day. After 72 h in an atmosphere of 5% CO2 at 37 °C, cells were detached from plates by incubation with 500 ml PBS containing 100 mg trypsin and 1 mmol/l EDTA. Cells were counted using a hemocytometer.

ELISA for CXCL10

CXCL10 levels were measured in culture supernatants using commercially available kits (R&D Systems). The mean minimum detectable dose was 1.67 pg/ml for CXCL10; the intra- and inter-assay coefficients of variation were 3.0 and 6.9%. Samples were assayed in duplicate. Quality control pools of low, normal or high concentration for all parameters were included in each assay.

Quantitative real-time PCR for TLR3 and WNT5a

Total RNA from the cells was extracted with the RNeasy Mini reagent kit according to the manufacturer's recommendations (Qiagen). TaqMan Reverse Transcription Reagents kit and Universal PCR SYBR Green were from Applied Biosystems (Forster City, CA, USA). Quantitative PCR human reference total RNA was purchased from Stratagene (La Jolla, CA, USA). Primers for the WNT5A (NM_003392.3; forward: caggacggtgtacaacctgg, reverse: cttctccttcagggcatcac), for TLR3 (NM_003265.2; forward: tcaaattaaagagttttctccagg, reverse: gcttctctgtaaggctggga) and for GAPDH (forward: tgcaccaccaactgcttagc and reverse: ggcatggactgtggtcatgag) were designed using Primer Blast software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Total RNA (400 ng) was reverse transcribed using TaqMan Reverse Transcription Reagents kit. Reverse transcription (RT) was performed in a final volume of 80 μl containing 500 mM KCl, 0.1 mM EDTA, 100 mM Tris–HCl (pH 8.3), 5.5 mM MgCl2, 500 μM of each dNTP, 2.5 μM random examers, 0.4 U/μl RNase inhibitor, and 1.25 U/μl Multiscribe Reverse Transcriptase. The RT reaction was performed at 25 °C for 10 min, 48 °C for 30 min, and 95 °C for 3 min. Measurement of gene expression was performed by quantitative real-time PCR (TaqMan). For each sample, 12.5 ng of cDNA were added to 10 μl of PCR mix containing each primer set and 1× Universal PCR SYBR Green. The samples were then subjected to 40 cycles of amplification at 95 °C for 15 s and 60 °C for 60 s in the ABI Prism 7700 Sequence Detector (Applied Biosystems). The amount of target, normalized to the endogenous reference GAPDH and relative to a calibrator (quantitative PCR human reference total RNA), was given by the 2−ΔΔCt (Livak & Schmittgen 2001).

Apoptosis determination: Hoechst uptake

PTC cells were seeded in a 96-wells microtiter plate at a concentration of 35 000 cells/ml in a final volume of 100 μl in each well. Then, cultures were incubated for 48 h with PPARγ activators (10 or 20 μmol/l, RGZ or pioglitazone), in a humidified atmosphere (37 °C, 5% CO2).

After 48 h of treatments, the cells were stained with 5 μg/ml of Hoechst 33342 for 10 min at 37 °C. At the end of the incubation time, adherent cells were collected and analyzed using a hemocytometer under a fluorescence microscope. Cells that incorporated the Hoechst dye and showed typical morphological apoptotic features, such as chromatin condensation, were considered apoptotic cells according to Schmid et al. (2007).

The apoptosis index (ratio between apoptotic and total cells)×100, was calculated. Data were analyzed by one-way ANOVA with Newman–Keuls multiple comparisons test.

Apoptosis determination: annexin V binding assay

The cells were plated in Lab-tekII Chamber Slide System (Nalge Nunc International, Roskilde, Denmark), treated with 10 or 20 μmol/l, RGZ or pioglitazone for 48 h. At the end of the incubation time, the cells were stained using the Annexin V-FIT Fluorescence Microscopy Kit (BD Biosciences, San Jose, CA, USA) following manufacturer's instruction, and observed under the fluorescence microscope (Leica). Images were captured by an online Leica DFC320 camera.

Nuclear extracts preparation

PTC and TFC cells were seeded in cell culture dishes at a concentration of 200 000 cells/ml in a final volume of 10 ml. Then, cells were treated (1 h) with IFNγ (1000 U/ml) and TNFα (10 ng/ml) in the absence or presence of 10 or 20 μmol/l RGZ or pioglitazone.

Nuclear extracts (nucleosol) were prepared according to the protocol of Andrews & Faller (1991), with some modifications.

All steps were performed on ice, with ice-cold reagent. Treated and untreated cells were collected in PBS and centrifugated at 1000 g for 2 min. The pellets were resuspended with buffer B (HEPES 10 mM pH 7.9, KCl 10 mM, MgCl2 2 mM and EDTA 200 μM, Triton X-100) 1%, with protease inhibitors (leupeptin 4 μg/ml, aprotinine 1 μg/ml and phenylmethylsulphonyl fluoride (PMSF) 1 mM) and phosphatase inhibitors (NaF 50 mM, Na3VO4 0.1 mM and β-glycerolphosphate 20 mM), left for 30 min on ice and centrifugated subsequently for 1 min at 10 000 g.

For the nuclear lysis, samples were incubated in agitation at 4 °C for 20–30 min in extraction buffer (HEPES 10 mM pH 7.9, NaCl 600 mM, 2MgCl2 1 mM and EDTA 200 μM, glycerol 25%) with protease inhibitors (leupeptin 4 μg/ml, aprotinine 1 μg/ml and PMSF 1 mM) and phosphatase inhibitors (NaF 50 mM, Na3VO4 0.1 mM and β-glycerolphosphate 20 mM) and then centrifugated at 20 000 g for 30 min. The supernatants were retained for use in the DNA binding assay.

Protein concentration was determinated by the BCA protein assay (Sigma).

Electrophoretic mobility shift assay

DNA binding reactions were performed in a 30 μl reaction volume with 20 μg of nuclear protein, double-stranded biotin-labeled probe (canonical NF-κB binding sequence: 5′ TTGGCAACGGCAGGGGAATTCCCCTCTCCTTA 3′; Primm, Milan, Italy), and acetylated BSA in a Binding Buffer 5× (glycerol 20%, MgCl2 5 mM, EDTA 2.5 mM, dithiothreitol (DTT) 2.5 mM, NaCl 250 mM, Tris–HCl 50 mM, pH 7.5 and poly (dI-dC) 0.25 mg/ml). Binding reactions were allowed to procede for 30 min on ice and samples were loaded onto nondenaturating 6% polyacrylamide gels. After electrophoresis, the gel was transferred on nylon membrane Hybond N (Amersham Biosciences Europe GmbH). The membrane was washed with SSC 2× (NaCl 0.3 M and Na citrate 0.03 M) for 5 min, then left to dry to the air and exposed to u.v. for 45 s. Blocking step was then performed incubating the membrane ‘overnight’ at room temperature with a solution composed of Dendhart's 10× (BSA 0.25%, Ficoll 400 0.25%, polivinilpirolidone 0.25%, SSC 6×, SDS 0.1%).

Detection of the biotinylated sequence was performed by using a chemiluminescence method with ‘Phototope – Star Detection kit’ (New England BioLabs, Inc., Ipswich, MA, USA) following the manufacturers instruction. Briefly, biotinylated DNA was detected on a membrane support by first exposing the membrane to streptavidin. Next, biotinylated alkaline phosphatase is added, resulting in the creation of a conjugate between the alkaline phosphatase and the DNA on the membrane. In final step, CDP – Star reagent was added. The acquisitions of the images were carried out with Chemi Doc (Bio-Rad Laboratories, Inc).

For competitor studies, a 100-fold excess of not-biotynilated probes were preincubated at room temperature for 10 min.

Immunoblotting

Papillary thyroid cancer cells were seeded in cell culture dishes at a concentration of 200 000 cells/ml in a final volume of 10 ml. Then, cells were treated (24 h) with IFNγ (1000 U/ml) and TNFα (10 ng/ml) in the absence or presence of 10 or 20 μmol/l RGZ or pioglitazone.

At the end of the treatments, cells were washed with PBS and collected in lysis buffer (25 mM HEPES, pH 7.7, 400 mM NaCl, 0.5% Triton X-100, 1.5 mM MgCl2, 2 mM DTT), protease inhibitors (leupeptin 4 μg/ml, aprotinine 1 μg/ml and PMSF 1 mM) and phosphatase inhibitors (NaF 50 mM, Na3VO4 0.1 mM and β-glycerolphosphate 20 mM).

SDS-PAGE was performed essentially using the method of Laemmli (1970), with 5% acrylamide for the stacking gel and 12% for the separating gel. The proteins were tranferred to nitrocellulose sheets (Bio-Rad Laboratories) following the methods of Towbin et al. (1979). Immunodetection was performed employing anti p-extracellular signal-regulated kinases (ERK) 1/2 and anti ERK1/2 (Cell Signaling, Danvers, MA, USA) and was revealed by peroxidase-labeled anti-rabbit IgG (Sigma) and BM Chemiluminiscence Blotting Substrate (POD; Roche). The acquisitions of the images were carried out with Chemi Doc (Bio-Rad Laboratories, Inc).

Data analysis

Values are given as mean±s.d. for normally distributed variables, otherwise as median and (interquartile range). Mean group values were compared by using one-way ANOVA for normally distributed variables, otherwise by the Mann–Whitney U or Kruskal–Wallis test. Proportions were compared by the χ2 test. Post-hoc comparisons on normally distributed variables were carried out using the Bonferroni–Dunn test.

Results

In primary normal TFC cultures, CXCL10 was undetectable in the supernatant. IFNγ dose-dependently induced the CXCL10 secretion (Fig. 1A), whereas TNFα alone had no effect. However, the combination of TNFα and IFNγ had a significant synergistic effect on the CXCL10 release (Fig. 2A). Treatment of thyrocytes with RGZ, added at the time of IFNγ and TNFα stimulation, dose-dependently inhibited CXCL10 release (Fig. 3A). A similar effect was observed with pioglitazone (Fig. 4A). RGZ or pioglitazone alone had no effect and did not affect cell vitality or total protein content (data not shown).

Figure 1
Figure 1

CXCL10 release from normal thyroid follicular cells (A) and from papillary thyroid cancer cells (B) was absent under basal conditions (0) and was significantly stimulated by increasing doses of IFNγ (P<0.0001 by ANOVA). The pattern of IFNγ stimulation was similar in normal thyrocytes and in papillary thyroid cancer cells. Bars are mean±s.e.m. *P<0.05 or less versus 0, and not significantly different from the preceding dose by Bonferroni–Dunn test.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

Figure 2
Figure 2

The combination of TNFα and IFNγ (1000 U/ml) had a significant synergistic effect on CXCL10 (A) release from normal thyroid follicular cells (P<0.001 by ANOVA). The combination of TNFα and IFNγ (1000 U/ml) had a significant synergistic effect on CXCL10 release from papillary thyroid cancer cells, too (P<0.001 by ANOVA) (B). The effect of TNFα and IFNγ on papillary thyroid cancer cells is more than ten times higher than in normal thyroid cells (P<0.001 by ANOVA). Bars are mean±s.e.m. *P<0.05 or less.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

Figure 3
Figure 3

Increasing doses of rosiglitazone (10, 20 μmol/l) inhibit CXCL10 (A) release from thyroid follicular cells stimulated with IFNγ (1000 U/ml) and TNFα (10 ng/ml), but stimulated CXCL10 release in papillary thyroid cancer cells (B) (P<0.01 by ANOVA). *P<0.05 or less versus 0, and significantly different from the preceding dose by Bonferroni–Dunn test.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

Figure 4
Figure 4

Increasing doses of pioglitazone (10, 20 μmol/l) inhibit CXCL10 (A) release from thyroid follicular cells stimulated with IFNγ (1000 U/ml) and TNFα (10 ng/ml), but stimulated CXCL10 release in papillary thyroid cancer cells (B) (P<0.01 by ANOVA). Bars are mean±s.e.m. *P<0.05 or less versus 0.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

The data obtained with TFC from normal thyroid tissue were different from those obtained from PTC patients. In PTC thyrocytes, CXCL10 was undetectable in the supernatant. IFNγ dose-dependently induced the CXCL10 release (Fig. 1B); the pattern of IFNγ stimulation was similar to that observed in normal thyrocytes. TNFα alone in PTC cells had a slight but significant effect (with TNFα 10 ng/ml; CXCL10, 26±15 pg/ml, versus 0 in controls; P<0.001, by ANOVA). The combination of TNFα and IFNγ had a significant synergistic effect on the CXCL10 secretion (Fig. 2B). The synergistic effect of TNFα and IFNγ was significantly stronger on the CXCL10 secretion in PTC cells than in normal thyrocytes (P<0.001; by ANOVA).

Treatment of PTC thyrocytes with RGZ, added at the time of IFNγ and TNFα stimulation, dose-dependently stimulated CXCL10 release (Fig. 3B). A similar effect was observed with pioglitazone (Fig. 4B). RGZ or pioglitazone alone had no effect and did not affect cell vitality or total protein content (data not shown).

The results of WST-1 assay in normal TFCs with 10 and 20 μmol/l RGZ showed a slight but not significant reduction of proliferation with respect to the control both at 1 h (data not shown) and at 2 h (Fig. 5A). Cells counting confirmed the above mentioned results. In control TFCs the cell number, at 2 h, was 19 350±580/100 μl, per well; after the treatments, the cell number was (at 2 h from the start of tetrazolium reaction) 17 635±588 (91%, with respect to the control) with RGZ 10 μmol/l; 17 211±591 (89%) with RGZ 20 μmol/l. The results of WST-1 assay in PTC cells showed a slight but significant reduction of proliferation with respect to the control with 10 and 20 μmol/l RGZ at 1 h (data not shown) and at 2 h (Fig. 5B). Cells counting confirmed the above mentioned results at 2 h. In control PTC the cell number was 17 830±1710/100 μl per well; 14 978±629 (84%) with RGZ 10 μmol/l; 12 841±2321 (72%) with RGZ 20 μmol/l.

Figure 5
Figure 5

The results of WST-1 assay (at 2 h from the start of tetrazolium reaction) (mean±s.e.m. of all samples) showed a slight but not significant reduction of proliferation with respect to the control with rosiglitazone (after 24 h of incubation) 10 or 20 μmol/l in normal thyroid follicular cells (A), while a significant (P<0.01; ANOVA) reduction of proliferation was observed in papillary thyroid cancer cells (B). Bars are mean±s.e.m. *P<0.05 or less versus 0.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

Similarly, the results of WST-1 assay in normal TFCs with 10 and 20 μmol/l pioglitazone showed a slight but not significant reduction of proliferation with respect to the control both at 1 h (data not shown) and at 2 h (Fig. 6A). Cells counting confirmed the above mentioned results. In control TFCs the cell number, at 2 h, was 19 520±650/100 μl, per well; after the treatments, the cell number was: (at 2 h from the start of tetrazolium reaction) 17 954±665 (92%, with respect to the control) with pioglitazone 10 μmol/l; 16 820±690 (90%) with pioglitazone 20 μmol/l. The results of WST-1 assay in PTC cells showed a slight but significant reduction of proliferation with respect to the control with 10 and 20 μmol/l pioglitazone at 1 h (data not shown) and at 2 h (Fig. 6B). Cells counting confirmed the above mentioned results at 2 h. In control PTC the cell number was 17 815±839/100 μl, per well; 14 786±502 (83%) with pioglitazone RGZ 10 μmol/l; 14 071±499 (79%) with pioglitazone 20 μmol/l.

Figure 6
Figure 6

The results of WST-1 assay (at 2 h from the start of tetrazolium reaction) (mean±s.e.m. of all samples) showed a slight but not significant reduction of proliferation with respect to the control with pioglitazone (after 24 h of incubation) 10 or 20 μmol/l in normal thyroid follicular cells (A), while a significant (P<0.01; ANOVA) reduction of proliferation was observed in papillary thyroid cancer cells (B). Bars are mean±s.e.m. *P<0.05 or less versus 0.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

Apoptosis index was determined in PTC thyrocytes by the Hoechst methods: cells incorporating the dye and showing typical morphological features were considered as apoptotic. Both control and cells treated with RGZ (10 and 20 μmol/l for 48 h) were stained with fluorescent Hoechst dye. The percentage of apoptotic cells increased markedly in a dose-dependent manner: after treatment with RGZ 10 μmol/l, 11.8% of the cells were apoptotic and such a percentage increased up to more than 19% with RGZ 20 μmol/l (P<0.001; by ANOVA; Fig. 7). At the pioglitazone lower dose 8% of the cells were apoptotic, and this percentage increased up to more than 10% with pioglitazone 20 μmol/l (P<0.01; by ANOVA). Annexin V was used to further confirm the induced cell apoptosis (merged panels, Fig. 7).

Figure 7
Figure 7

Apoptosis in papillary thyroid cancer cells treated with rosiglitazone 10 (ROSI10) and 20 μmol/l (ROSI20) for 48 h. Apoptosis index was determined by Hoechst staining (see Materials and methods). The percentage of apoptotic cells increased markedly in a dose-dependent manner: after treatment with RGZ 10 μmol/l, 11.8% of the cells were apoptotic and such a percentage increased up to more than 19% with RGZ 20 μmol/l (P<0.001; by ANOVA). Data are expressed as means±s.d. (n=5). Data were analyzed by one-way ANOVA with Newman–Keuls multiple comparisons test and with a test for linear trend (P<0.001, for ROSI20 versus ROSI10 or control; P<0.001 for ROSI10 versus control). The merged panels show a representative example of annexin V binding assay in treated and control cells.

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

In order to explain the inhibition exerted by PPARγ agonists on CXCL10 secretion, the effect of TZDs on NF-κB activation in the PTC cells has been evaluated, by electrophoretic mobility shift assay (Fig. 8). The untreated PTC cells showed a constitutive activation of NF-κB (lane 1–2) and the treatment with IFNγ and TNFα enhanced the DNA binding activity of NF-κB (lane 3–4). The treatments with RGZ or pioglitazone (20 μmol/l) significantly reduced the IFNγ and TNFα activation of NF-κB (lane 5–6 and 7–8 respectively) and, although to a less extent, even the treatment with the lower dose (10 μmol/l) inhibited the nuclear translocation of such transcription factor (lane 9 and 10). Normal TFC did not show a constitutive activation of NF-κB, which was induced by IFNγ and TNFα, and inhibited by PPARγ agonists (data not shown).

Figure 8
Figure 8

Electrophoretic mobility shift assay (EMSA) of papillary thyroid cancer cells nuclear extracts: (A) lane 1–2, constitutive NF-κB binding activity in papillary thyroid cancer cells; lane 3–4, treatment with ‘IFNγ (1000 U/ml) and TNFα (10 ng/ml)’ (IFNγ+TNFα); lane 5–6, treatment with IFNγ+TNFα and pioglitazone (20 μmol/l); lane 7–8, treatment with IFNγ+TNFα and rosiglitazone (20 μmol/l); lane 9, treatment with IFNγ+TNFα and rosiglitazone (10 μmol/l); lane 10, treatment with IFNγ+TNFα and pioglitazone (10 μmol/l). The untreated PTC cells showed a constitutive activation of NF-κB (lane 1–2) and the treatment with IFNγ+TNFα enhanced the DNA binding activity of NF-κB (lane 3–4). The treatments with RGZ or pioglitazone (20 μmol/l) significantly reduced the IFNγ+TNFα activation of NF-κB (lane 5–6 and 7–8 respectively) and, although to a less extent, even the treatment with the lower dose (10 μmol/l) inhibited the nuclear translocation of such transcription factor (lane 9 and 10). (B) This figure shows the competition test (nuclear extracts were preincubated with a 100-fold molar excess of unlabeled probe): lane 1, constitutive NF-κB in control cells; lane 2, treatment with IFNγ+TNFα; lane 3, treatment with IFNγ+TNFα and pioglitazone (20 μmol/l); lane 4, treatment with IFNγ+TNFα and rosiglitazone (20 μmol/l); lane 5, treatment with IFNγ+TNFα and pioglitazone (10 μmol/l); lane 6, treatment with IFNγ+TNFα and rosiglitazone (10 μmol/l).

Citation: Endocrine-Related Cancer 16, 4; 10.1677/ERC-08-0337

As far as the MAP-kinase ERK1/2, there were no significant differences neither in the level of ERK1/2 phosphorylation or in the amount of not-phosphorylated protein expression between untreated and treated PTC cells (data not shown).

The V600EBRAF mutation was observed in three PTC. The results about the stimulation with IFNγ and/or TNFα on the chemokines secretion, the modulation of chemokines secretion by RGZ and/or pioglitazone, and of the inhibition of proliferation by PPARγ activators, obtained in PTC from tumors with V600EBRAF mutation, were similar to those from tumors without BRAF mutations (data not shown).

TLR3 and WNT5a mRNAs were detectable in all primary cells derived from papillary carcinomas. According to real time RT-PCR results, the TLR3 expression versus the reference gene (GAPDH) ranges from 0.8 to 1.2, while the expression of WNT5a from 4.15 to 4.90.

Discussion

The results of the present study demonstrate that: firstly, both IFNγ and TNFα (synergistically with IFNγ) dose-dependently induce an exaggerated release of CXCL10 by primary thyrocytes from PTC, with respect to normal TFC; and secondly, the PPARγ agonists, RGZ and pioglitazone, exert a dose-dependent inhibition of proliferation of PTC cells, but (in contrast to normal TFC) have stimulatory effect on CXCL10 release.

Our data are in agreement with those found in other studies that demonstrate an overexpression of CXCL10 in PTC. In PTCs, rearrangements of the RET receptor (RET/PTC) and activating mutations in the BRAF or RAS oncogenes are mutually exclusive. It has been shown that the three proteins function along a linear oncogenic signaling cascade in which RET/PTC induces RAS-dependent BRAF activation and RAS- and BRAF-dependent ERK activation. Adoptive activation of the RET/PTC–RAS–BRAF axis induced cell proliferation of thyroid follicular cells. Gene expression profiling revealed that the three oncogenes activate a common transcriptional program in thyroid cells that includes upregulation of the CXCL1 and CXCL10 chemokines, which in turn stimulate proliferation and invasion (Melillo et al. 2005).

Furthermore, RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response, among them CXCL10 (Puxeddu et al. 2005).

The results of our study confirm that TLR3 and WNT5a are expressed in primary cells derived from PTC (McCall et al. 2007, Schweppe et al. 2008). WNT5a levels in PTC cells may be related to high TLR3 levels and signaling. The basally expressed TLR3 are functional in PTC cells as evidenced by the ability of double-strand RNA (polyinosine–polycytidylic acid) to increase significantly the activity of transfected NF-κB and IFNβ luciferase reporter genes and the levels of two end products of TLR3 signaling, IFNβ and CXCL10. This may explain, at least in part, the mechanism of the induction of CXCL10 secretion by cytokines in PTC (McCall et al. 2007).

In our study, the synergistic effect of TNFα and IFNγ on CXCL10 release was more than ten times higher in PTC cells than in normal thyrocytes, confirming that the genetic abnormalities underlying the neoplastic transformation in PTC lead to an overexpression of CXCL10, that is functionally expressed in an exaggerated response of the chemokine under the influence of the stimulatory cytokines IFNγ and TNFα.

The modest but significant increase of CXCL10 after stimulation with TNFα alone may also be due to the above mentioned genetic abnormalities.

In the last few years, it has been increasingly shown that chemokines play an important role in tumor progression and chemokine receptors can sustain proliferation, angiogenesis and survival, and promote organ-specific localization of distant metastases. The expression of chemokines in human malignancies is associated with a leukocyte infiltration and with immune escape mechanisms. Important studies have been conducted on the preclinical testing of cancer therapies based on interference with the cancer chemokine network. For example, the blockade of agents and antibodies against CXCR4 prevent the establishment of metastasis; in mouse models, overexpression of selected chemokines causes tumor infiltration by distinct leukocyte subsets, resulting in tumor regression and tumor-specific immunity generation; moreover, chemokines have also been successfully used as carriers and/or adjuvants for cancer vaccines (Ruffini et al. 2007, Yang et al. 2008).

The cancer chemokine network is a multifaceted therapeutic target. CXCL10 chemokine stimulates proliferation and invasion in PTC (Melillo et al. 2005); in this view, agents that prevent CXCL10 production or action should be tested in PTC refractory to traditional treatments.

PPARγ has recently been shown to modulate inflammatory responses in many cell types, such as endothelial cells (Marx et al. 2000, Gosset et al. 2001, Schaefer et al. 2005), dendritic cells (Gosset et al. 2001), and in other kinds of cells (Yang et al. 2008). Furthermore, we have recently shown (Antonelli et al. 2006) that treatment of TFC, orbital fibroblasts or preadipocytes with a pure PPARγ activator, RGZ, significantly inhibited IFNγ-stimulated CXCL10 secretion, strongly suggesting that PPARγ might be involved in the regulation of IFNγ-induced chemokine expression in human thyroid autoimmunity and Graves' ophthalmopathy. The results of our study confirm the above mentioned results in normal TFC, but first demonstrate that treatment of PTC cells with two pure PPARγ activators, RGZ and pioglitazone, at near-therapeutical doses, increased the IFNγ-stimulated CXCL10 secretion, strongly reinforcing the hypothesis that PPARγ might be involved in the regulation of IFNγ-induced chemokine expression in human thyroid cells (Schaefer et al. 2005).

With regard to the mechanism of action on chemokine secretion, PPARγ activators may act in different ways: either, decreasing CXCL10 promoter activity and inhibiting protein binding to the two NF-κB sites (Marx et al. 2000); or, TZDs reduce CXCL10 protein levels in a dose-dependent manner at concentrations (nanomolar) that did not affect mRNA levels or NF-κB activation (Schaefer et al. 2005). More recently, it has been shown that the TZD effect is not only mediated by activation of the NF-κB and Stat1 classic pathways, but also involves a rapid increase in phosphorylation and activation of ERK1/2 (Lombardi et al. 2008).

Our results in PTC cells show that NF-κB is basally activated in PTC cells and that TZDs are able to inhibit the NF-κB activation, in agreement with the effect observed by Marx et al. (2000). This result parallels the effect of TZDs on PTC proliferation, but is opposed to the effect of TZDs on CXCL10 secretion, suggesting that other pathways are involved in the chemokine modulation. Regards MAP-kinase ERK1/2, we were unable to show any significant differences either in the level of ERK1/2 phosphorylation or in the amount of not-phosphorylated protein expression between untreated and treated thyroid cells, in contrast to the results obtained in endothelial cells (Lombardi et al. 2008).

It can be hypothesized that, while PPARγ activators have a physiologically inhibitory role on chemokine secretion, the derangement of the pathways regulating CXCL10 expression may lead to an unexpected stimulatory response in PTC.

PPARγ are members of a superfamily of nuclear hormone receptors (Grommes et al. 2004). Activation of PPARγ isoforms elicits both anti-neoplastic (Grommes et al. 2004, Garcia-Bates et al. 2008) and anti-inflammatory effects (Antonelli et al. 2006) in several types of mammalian cells. Recently, it has been shown that agonists of PPARγ induce apoptosis and exert antiproliferative effects on human papillary carcinoma cells (Ohta et al. 2001), prevent distant metastasis of BHP18–21 tumors in nude mice in vivo (Ohta et al. 2001), and induce redifferentiation in thyroid cancer cell lines (Klopper et al. 2004, Philips et al. 2004, Frohlich et al. 2005, Park et al. 2005, Aiello et al. 2006), demonstrating effective therapeutic agents for the treatment of patients with thyroid cancer that fail to respond to traditional treatments (Klopper et al. 2004, Philips et al. 2004, Frohlich et al. 2005, Park et al. 2005). Moreover, the expression of PPARγ gene and protein were examined in five human anaplastic cancer cell lines (Hayashi et al. 2004). The five cell lines showed higher levels of the PPARγ gene and protein expression than papillary thyroid cancer, and PPARγ agonists down regulated their invasive potential (Hayashi et al. 2004). These results have been confirmed by other studies (Park et al. 2005).

Furthermore, we have recently shown in primary cultured human anaplastic and papillary dedifferentiated thyroid cancer cells the antiproliferative effect of PPARγ agonists TZD (Antonelli et al. 2008a,b).

The results of our study fully confirmed that PPARγ agonists are not able to exert an inhibitory role in normal TFC, while demonstrate a significant antiproliferative effect of TZDs in PTC primary cell cultures. Interestingly, the antiproliferative effect of PPARγ activators in PTC is dissociated from the ability to inhibit the IFNγ-stimulated CXCL10 secretion: PPARγ activators increase the IFNγ and TNFα stimulated CXCL10 secretion in PTC, in contrast to that observed in normal TFC, where an inhibitory role of TZDs was observed. The discrepancy between the stimulatory effect of TZDs on CXCL10 secretion and the inhibitory role on PTC proliferation is probably due to the different pathways involved.

In fact, TZDs mediate growth inhibition through induction of apoptosis. Our results confirm that both RGZ and pioglitazone are able to induce apoptosis in PTC cells. Even with regard to thyroid carcinoma, there is controversy on the induction of apoptosis by TZD in relation to the proto-oncogene, c-myc, or cell cycle inhibitor protein, p27 (Ohta et al. 2001, Martelli et al. 2002). Other findings suggested that PPARγ agonists should induce apoptosis in thyroid carcinoma cell lines through up-regulation of Bax protein (Hayashi et al. 2004).

BRAF provides crucial signals for proliferation of thyroid carcinoma cells spontaneously harboring the V600EBRAF mutation and, therefore, BRAF suppression might have therapeutic potential in V600EBRAF-positive thyroid cancer (Salvatore et al. 2006, Benvenga 2008). Our results show that PPARγ agonists act both in PTC with or without V600EBRAF mutation, suggesting that the effect of TZD is mediated by other mechanisms; furthermore, no significant effect of V600EBRAF mutation was observed on chemokine secretion. However, owing to the small number of patients (three with and three without BRAF mutation) further studies in larger series will be needed.

In conclusion, the present study demonstrates that IFNγ and TNFα (synergistically) induce a huge release of CXCL10 by primary thyrocytes from PTC. Since CXCL10 stimulate proliferation and invasion, agents that prevent CXCL10 production or action should be tested in PTC refractory to traditional treatments. A discrepancy between the stimulatory effect of TZDs on CXCL10 secretion and the inhibitory role on PTC proliferation is shown.

Declaration of interest

There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

References

  • AielloAPandiniGFrascaFConteEMurabitoASaccoAGenuaMVigneriRBelfioreA2006Peroxisomal proliferator-activated receptor-γ agonists induce partial reversion of epithelial–mesenchymal transition in anaplastic thyroid cancer cells. Endocrinology14744634475.

    • Search Google Scholar
    • Export Citation
  • AndrewsNCFallerDV1991A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Research192499.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFallahiPRomagnaniPFerrariSMBuonamanoAFerranniniESerioM2004High levels of circulating CXCL10 are associated with chronic autoimmune thyroiditis and hypothyroidism. Journal of Clinical Endocrinology and Metabolism8954965499.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFallahiPRomagnaniPFerrariSMPaolicchiAFerranniniESerioM2005Increase of interferon-γ inducible alpha chemokine CXCL10 but not beta chemokine CCL2 serum levels in chronic autoimmune thyroiditis. European Journal of Endocrinology152171177.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFerrariSMFallahiPRomagnaniPFranceschiniSSSerioMFerranniniE2006Interferon-γ-inducible alpha-chemokine CXCL10 involvement in Graves' ophthalmopathy: modulation by peroxisome proliferator-activated receptor-γ agonists. Journal of Clinical Endocrinology and Metabolism91614620.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGMarchettiIUgoliniCBasoloFMiccoliPFerranniniE2008aEvaluation of the sensitivity to chemotherapeutics or thiazolidinediones of primary anaplastic thyroid cancer cells obtained by fine-needle aspiration. European Journal of Endocrinology159283291.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFallahiPFerrariSMCarpiABertiPMaterazziGMinutoMGuastalliMMiccoliP2008bDedifferentiated thyroid cancer: a therapeutic challenge. Biomedicine and Pharmacotherapy62559563.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGBaraniLMarchettiIFerranniniEMiccoliP2008cPrimary cell cultures from anaplastic thyroid cancer obtained by fine-needle aspiration used for chemosensitivity tests. Clinical Endocrinology69148152.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGMinutoMGianniniRMarchettiIBaraniLBasoloF2009Thiazolidinediones and antiblastics in primary human anaplastic thyroid cancer cells. Clinical Endocrinology70946953.

    • Search Google Scholar
    • Export Citation
  • BenvengaS2008Update on thyroid cancer. Hormone and Metabolic Research40323328.

  • DewaldBMoserBBarellaLSchumacherCBaggioliniMClark-LewisI1992IP-10, a γ-interferon-inducible protein related to interleukin-8, lacks neutrophil activating properties. Immunology Letters328184.

    • Search Google Scholar
    • Export Citation
  • FrohlichEMachicaoFWahlR2005Action of thiazolidinediones on differentiation, proliferation and apoptosis of normal and transformed thyrocytes in culture. Endocrine-Related Cancer12291303.

    • Search Google Scholar
    • Export Citation
  • Garcia-BatesTMLehmannGMSimpson-HaidarisPJBernsteinSHSimePJPhippsRP2008Role of peroxisome proliferator-activated receptor γ and its ligands in the treatment of hematological malignancies. PPAR Research2008834612.

    • Search Google Scholar
    • Export Citation
  • Garcià-LòpezMASanchoDSànchez-MadridFMarazuelaM2001Thyrocytes from autoimmune thyroid disorders produce the chemokines IP-10 and Mig and attract CXCR3+ lymphocytes. Journal of Clinical Endocrinology and Metabolism8650085016.

    • Search Google Scholar
    • Export Citation
  • GossetPCharbonnierASDelerivePFontaineJStaelsBPestelJTonnelABTrotteinF2001Peroxisome proliferator-activated receptor γ activators affect the maturation of human monocyte-derived dendritic cells. European Journal of Immunology3128572865.

    • Search Google Scholar
    • Export Citation
  • GrommesCLandrethGEHenekaMT2004Antineoplastic effects of peroxisome proliferator activated receptor-γ agonists. Lancet Oncology5419429.

    • Search Google Scholar
    • Export Citation
  • Gutiérrez-CañasIRodrìguez-HencheNBolañosOCarmenaMJPrietoJCJuarranzMG2003VIP and PACAP are autocrine factors that protect the androgen-independent prostate cancer cell line PC-3 from apoptosis induced by serum withdrawal. British Journal of Pharmacology13910501058.

    • Search Google Scholar
    • Export Citation
  • HayashiNNakamoriSHiraokaNTsujieMXundiXTakanoTAminoNSakonMMondenM2004Antitumor effects of peroxisome proliferator activate receptor γ ligands on anaplastic thyroid carcinoma. International Journal of Oncology248995.

    • Search Google Scholar
    • Export Citation
  • KempEHMetcalfeRASmithKAWoodroofeMNWatsonPFWeetmanAP2003Detection and localization of chemokine gene expression in autoimmune thyroid disease. Clinical Endocrinology59207213.

    • Search Google Scholar
    • Export Citation
  • KlopperJPHaysWRSharmaVBaumbuschMAHershmanJMHaugenBR2004Retinoid X receptor-γ and peroxisome proliferator-activated receptor-γ expression predicts thyroid carcinoma cell response to retinoid and thiazolidinedione treatment. Molecular Cancer Therapeutics310111020.

    • Search Google Scholar
    • Export Citation
  • KrollTGSarrafPPecciariniLChenCJMuellerESpiegelmanBMFletcherJA2000PAX8–PPARγ1 fusion oncogene in human thyroid carcinoma. Science28913571360.

    • Search Google Scholar
    • Export Citation
  • LaemmliUK1970Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature227680685.

  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCt. Methods25402408.

    • Search Google Scholar
    • Export Citation
  • LoetscherMGerberBLoetscherPJonesSAPialiLClark-LewisIBaggioliniMMoserB1996Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. Journal of Experimental Medicine184963969.

    • Search Google Scholar
    • Export Citation
  • LombardiACantiniGPiscitelliEGelminiSFrancalanciMMelloTCeniEVaranoGFortiGRotondiM2008A new mechanism involving ERK contributes to rosiglitazone inhibition of tumor necrosis factor-alpha and interferon-γ inflammatory effects in human endothelial cells. Arteriosclerosis Thrombosis and Vascular Biology28718724.

    • Search Google Scholar
    • Export Citation
  • LusterAD1998Chemokines – chemotactic cytokines that mediate inflammation. New England Journal of Medicine338436445.

  • MackayCR1996Chemokine receptors and T cell chemotaxis. Journal of Experimental Medicine184799802.

  • MartelliMLIulianoRLe PeraISamaIMonacoCCammarotaSKrollTChiariottiLSantoroMFuscoA2002Inhibitory effects of peroxisome poliferator-activated receptor γ on thyroid carcinoma cell growth. Journal of Clinical Endocrinology and Metabolism8747284735.

    • Search Google Scholar
    • Export Citation
  • MarxNMachFSautyALeungJHSarafiMNRansohoffRMLibbyPPlutzkyJLusterAD2000Peroxisome proliferator-activated receptor-γ activators inhibit IFN-γ-induced expression of the T cell-active CXC chemokines IP-10, Mig, and I-TAC in human endothelial cells. Journal of Immunology16465036508.

    • Search Google Scholar
    • Export Citation
  • McCallKDHariiNLewisCJMalgorRKimWBSajiMKohnADMoonRTKohnLD2007High basal levels of functional Toll-like receptor 3 (TLR3) and noncanonical Wnt5a are expressed in papillary thyroid cancer and are coordinately decreased by phenylmethimazole together with cell proliferation and migration. Endocrinology14842264237.

    • Search Google Scholar
    • Export Citation
  • MelilloRMCastelloneMDGuarinoVDe FalcoVCiraficiAMSalvatoreGCaiazzoFBasoloFGianniniRKruhofferM2005The RET/PTC–RAS–BRAF linear signaling cascade mediates the motile and mitogenic phenotype of thyroid cancer cells. Journal of Clinical Investigation11510681081.

    • Search Google Scholar
    • Export Citation
  • OhtaKEndoTHaraguchiKHershmanJMOnayaT2001Ligands for peroxisome proliferator-activated receptor γ inhibit growth and induce apoptosis of human papillary thyroid carcinoma cells. Journal of Clinical Endocrinology and Metabolism8621702177.

    • Search Google Scholar
    • Export Citation
  • ParkJWZarnegarRKanauchiHWongMGHyunWCGinzingerDGLoboMCotterPDuhQYClarkOH2005Troglitazone, the peroxisome proliferator-activated receptor-γ agonist, induces antiproliferation and redifferentiation in human thyroid cancer cell lines. Thyroid15222231.

    • Search Google Scholar
    • Export Citation
  • PhilipsJCPetiteCWilliJPBucheggerFMeierCA2004Effect of peroxisome proliferator-activated receptor γ agonist, rosiglitazone, on dedifferentiated thyroid cancers. Nuclear Medicine Communications2511831186.

    • Search Google Scholar
    • Export Citation
  • PuxedduEKnaufJASartorMAMitsutakeNSmithEPMedvedovicMTomlinsonCRMorettiSFaginJA2005RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response. Endocrine-Related Cancer12319334.

    • Search Google Scholar
    • Export Citation
  • RomagnaniPRotondiMLazzeriELasagniLFrancalanciMBuonamanoAMilaniSVittiPChiovatoLTonaccheraM2002Expression of IP-10/CXCL10 and Mig/CXCL9 in the thyroid and increased serum levels of IP-10/CXCL10 in the serum of subjects with recent onset Graves'disease. American Journal of Pathology161195206.

    • Search Google Scholar
    • Export Citation
  • RuffiniPAMorandiPCabiogluNAltundagKCristofanilliM2007Manipulating the chemokine–chemokine receptor network to treat cancer. Cancer10923922394.

    • Search Google Scholar
    • Export Citation
  • SalvatoreGDe FalcoVSalernoPNappiTCPepeSTronconeGCarlomagnoFMelilloRMWilhelmSMSantoroM2006BRAF is a therapeutic target in aggressive thyroid carcinoma. Clinical Cancer Research1216231629.

    • Search Google Scholar
    • Export Citation
  • SchaeferKLDenevichSMaCCooleySRNakajimaAWadaKSchlezingerJSherrDSaubermannLJ2005Intestinal antiinflammatory effects of thiazolidenedione peroxisome proliferator-activated receptor-γ ligands on T Helper Type 1 chemokine regulation include nontranscriptional control mechanisms. Inflammatory Bowel Diseases11244252.

    • Search Google Scholar
    • Export Citation
  • SchmidIUittenbogaartCJamiesonBD2007Live-cell assay for detection of apoptosis by dual-laser flow cytometry using Hoechst 33342 and 7-amino-actinomycin D. Nature Protocols2187190.

    • Search Google Scholar
    • Export Citation
  • SchweppeREKlopperJPKorchCPugazhenthiUBenezraMKnaufJAFaginJAMarlowLACoplandJASmallridgeRC2008Deoxyribonucleic acid profiling analysis of 40 human thyroid cancer cell lines reveals cross-contamination resulting in cell line redundancy and misidentification. Journal of Clinical Endocrinology and Metabolism9343314341.

    • Search Google Scholar
    • Export Citation
  • TaubDDLloydARConlonKWangJMOrtaldoJRHaradaAMatsushimaKKelvinDJOppenheimJJ1993Recombinant human interferon-inducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells. Journal of Experimental Medicine17718091814.

    • Search Google Scholar
    • Export Citation
  • TowbinHStaehelinTGordonJ1979Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. PNAS7643504354.

    • Search Google Scholar
    • Export Citation
  • YangXYWangLHFarrarWL2008A role for PPARγ in the regulation of cytokines in immune cells and cancer. PPAR Research2008961753.

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 1037 260 13
PDF Downloads 212 90 7
  • View in gallery

    CXCL10 release from normal thyroid follicular cells (A) and from papillary thyroid cancer cells (B) was absent under basal conditions (0) and was significantly stimulated by increasing doses of IFNγ (P<0.0001 by ANOVA). The pattern of IFNγ stimulation was similar in normal thyrocytes and in papillary thyroid cancer cells. Bars are mean±s.e.m. *P<0.05 or less versus 0, and not significantly different from the preceding dose by Bonferroni–Dunn test.

  • View in gallery

    The combination of TNFα and IFNγ (1000 U/ml) had a significant synergistic effect on CXCL10 (A) release from normal thyroid follicular cells (P<0.001 by ANOVA). The combination of TNFα and IFNγ (1000 U/ml) had a significant synergistic effect on CXCL10 release from papillary thyroid cancer cells, too (P<0.001 by ANOVA) (B). The effect of TNFα and IFNγ on papillary thyroid cancer cells is more than ten times higher than in normal thyroid cells (P<0.001 by ANOVA). Bars are mean±s.e.m. *P<0.05 or less.

  • View in gallery

    Increasing doses of rosiglitazone (10, 20 μmol/l) inhibit CXCL10 (A) release from thyroid follicular cells stimulated with IFNγ (1000 U/ml) and TNFα (10 ng/ml), but stimulated CXCL10 release in papillary thyroid cancer cells (B) (P<0.01 by ANOVA). *P<0.05 or less versus 0, and significantly different from the preceding dose by Bonferroni–Dunn test.

  • View in gallery

    Increasing doses of pioglitazone (10, 20 μmol/l) inhibit CXCL10 (A) release from thyroid follicular cells stimulated with IFNγ (1000 U/ml) and TNFα (10 ng/ml), but stimulated CXCL10 release in papillary thyroid cancer cells (B) (P<0.01 by ANOVA). Bars are mean±s.e.m. *P<0.05 or less versus 0.

  • View in gallery

    The results of WST-1 assay (at 2 h from the start of tetrazolium reaction) (mean±s.e.m. of all samples) showed a slight but not significant reduction of proliferation with respect to the control with rosiglitazone (after 24 h of incubation) 10 or 20 μmol/l in normal thyroid follicular cells (A), while a significant (P<0.01; ANOVA) reduction of proliferation was observed in papillary thyroid cancer cells (B). Bars are mean±s.e.m. *P<0.05 or less versus 0.

  • View in gallery

    The results of WST-1 assay (at 2 h from the start of tetrazolium reaction) (mean±s.e.m. of all samples) showed a slight but not significant reduction of proliferation with respect to the control with pioglitazone (after 24 h of incubation) 10 or 20 μmol/l in normal thyroid follicular cells (A), while a significant (P<0.01; ANOVA) reduction of proliferation was observed in papillary thyroid cancer cells (B). Bars are mean±s.e.m. *P<0.05 or less versus 0.

  • View in gallery

    Apoptosis in papillary thyroid cancer cells treated with rosiglitazone 10 (ROSI10) and 20 μmol/l (ROSI20) for 48 h. Apoptosis index was determined by Hoechst staining (see Materials and methods). The percentage of apoptotic cells increased markedly in a dose-dependent manner: after treatment with RGZ 10 μmol/l, 11.8% of the cells were apoptotic and such a percentage increased up to more than 19% with RGZ 20 μmol/l (P<0.001; by ANOVA). Data are expressed as means±s.d. (n=5). Data were analyzed by one-way ANOVA with Newman–Keuls multiple comparisons test and with a test for linear trend (P<0.001, for ROSI20 versus ROSI10 or control; P<0.001 for ROSI10 versus control). The merged panels show a representative example of annexin V binding assay in treated and control cells.

  • View in gallery

    Electrophoretic mobility shift assay (EMSA) of papillary thyroid cancer cells nuclear extracts: (A) lane 1–2, constitutive NF-κB binding activity in papillary thyroid cancer cells; lane 3–4, treatment with ‘IFNγ (1000 U/ml) and TNFα (10 ng/ml)’ (IFNγ+TNFα); lane 5–6, treatment with IFNγ+TNFα and pioglitazone (20 μmol/l); lane 7–8, treatment with IFNγ+TNFα and rosiglitazone (20 μmol/l); lane 9, treatment with IFNγ+TNFα and rosiglitazone (10 μmol/l); lane 10, treatment with IFNγ+TNFα and pioglitazone (10 μmol/l). The untreated PTC cells showed a constitutive activation of NF-κB (lane 1–2) and the treatment with IFNγ+TNFα enhanced the DNA binding activity of NF-κB (lane 3–4). The treatments with RGZ or pioglitazone (20 μmol/l) significantly reduced the IFNγ+TNFα activation of NF-κB (lane 5–6 and 7–8 respectively) and, although to a less extent, even the treatment with the lower dose (10 μmol/l) inhibited the nuclear translocation of such transcription factor (lane 9 and 10). (B) This figure shows the competition test (nuclear extracts were preincubated with a 100-fold molar excess of unlabeled probe): lane 1, constitutive NF-κB in control cells; lane 2, treatment with IFNγ+TNFα; lane 3, treatment with IFNγ+TNFα and pioglitazone (20 μmol/l); lane 4, treatment with IFNγ+TNFα and rosiglitazone (20 μmol/l); lane 5, treatment with IFNγ+TNFα and pioglitazone (10 μmol/l); lane 6, treatment with IFNγ+TNFα and rosiglitazone (10 μmol/l).

  • AielloAPandiniGFrascaFConteEMurabitoASaccoAGenuaMVigneriRBelfioreA2006Peroxisomal proliferator-activated receptor-γ agonists induce partial reversion of epithelial–mesenchymal transition in anaplastic thyroid cancer cells. Endocrinology14744634475.

    • Search Google Scholar
    • Export Citation
  • AndrewsNCFallerDV1991A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Research192499.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFallahiPRomagnaniPFerrariSMBuonamanoAFerranniniESerioM2004High levels of circulating CXCL10 are associated with chronic autoimmune thyroiditis and hypothyroidism. Journal of Clinical Endocrinology and Metabolism8954965499.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFallahiPRomagnaniPFerrariSMPaolicchiAFerranniniESerioM2005Increase of interferon-γ inducible alpha chemokine CXCL10 but not beta chemokine CCL2 serum levels in chronic autoimmune thyroiditis. European Journal of Endocrinology152171177.

    • Search Google Scholar
    • Export Citation
  • AntonelliARotondiMFerrariSMFallahiPRomagnaniPFranceschiniSSSerioMFerranniniE2006Interferon-γ-inducible alpha-chemokine CXCL10 involvement in Graves' ophthalmopathy: modulation by peroxisome proliferator-activated receptor-γ agonists. Journal of Clinical Endocrinology and Metabolism91614620.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGMarchettiIUgoliniCBasoloFMiccoliPFerranniniE2008aEvaluation of the sensitivity to chemotherapeutics or thiazolidinediones of primary anaplastic thyroid cancer cells obtained by fine-needle aspiration. European Journal of Endocrinology159283291.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFallahiPFerrariSMCarpiABertiPMaterazziGMinutoMGuastalliMMiccoliP2008bDedifferentiated thyroid cancer: a therapeutic challenge. Biomedicine and Pharmacotherapy62559563.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGBaraniLMarchettiIFerranniniEMiccoliP2008cPrimary cell cultures from anaplastic thyroid cancer obtained by fine-needle aspiration used for chemosensitivity tests. Clinical Endocrinology69148152.

    • Search Google Scholar
    • Export Citation
  • AntonelliAFerrariSMFallahiPBertiPMaterazziGMinutoMGianniniRMarchettiIBaraniLBasoloF2009Thiazolidinediones and antiblastics in primary human anaplastic thyroid cancer cells. Clinical Endocrinology70946953.

    • Search Google Scholar
    • Export Citation
  • BenvengaS2008Update on thyroid cancer. Hormone and Metabolic Research40323328.

  • DewaldBMoserBBarellaLSchumacherCBaggioliniMClark-LewisI1992IP-10, a γ-interferon-inducible protein related to interleukin-8, lacks neutrophil activating properties. Immunology Letters328184.

    • Search Google Scholar
    • Export Citation
  • FrohlichEMachicaoFWahlR2005Action of thiazolidinediones on differentiation, proliferation and apoptosis of normal and transformed thyrocytes in culture. Endocrine-Related Cancer12291303.

    • Search Google Scholar
    • Export Citation
  • Garcia-BatesTMLehmannGMSimpson-HaidarisPJBernsteinSHSimePJPhippsRP2008Role of peroxisome proliferator-activated receptor γ and its ligands in the treatment of hematological malignancies. PPAR Research2008834612.

    • Search Google Scholar
    • Export Citation
  • Garcià-LòpezMASanchoDSànchez-MadridFMarazuelaM2001Thyrocytes from autoimmune thyroid disorders produce the chemokines IP-10 and Mig and attract CXCR3+ lymphocytes. Journal of Clinical Endocrinology and Metabolism8650085016.

    • Search Google Scholar
    • Export Citation
  • GossetPCharbonnierASDelerivePFontaineJStaelsBPestelJTonnelABTrotteinF2001Peroxisome proliferator-activated receptor γ activators affect the maturation of human monocyte-derived dendritic cells. European Journal of Immunology3128572865.

    • Search Google Scholar
    • Export Citation
  • GrommesCLandrethGEHenekaMT2004Antineoplastic effects of peroxisome proliferator activated receptor-γ agonists. Lancet Oncology5419429.

    • Search Google Scholar
    • Export Citation
  • Gutiérrez-CañasIRodrìguez-HencheNBolañosOCarmenaMJPrietoJCJuarranzMG2003VIP and PACAP are autocrine factors that protect the androgen-independent prostate cancer cell line PC-3 from apoptosis induced by serum withdrawal. British Journal of Pharmacology13910501058.

    • Search Google Scholar
    • Export Citation
  • HayashiNNakamoriSHiraokaNTsujieMXundiXTakanoTAminoNSakonMMondenM2004Antitumor effects of peroxisome proliferator activate receptor γ ligands on anaplastic thyroid carcinoma. International Journal of Oncology248995.

    • Search Google Scholar
    • Export Citation
  • KempEHMetcalfeRASmithKAWoodroofeMNWatsonPFWeetmanAP2003Detection and localization of chemokine gene expression in autoimmune thyroid disease. Clinical Endocrinology59207213.

    • Search Google Scholar
    • Export Citation
  • KlopperJPHaysWRSharmaVBaumbuschMAHershmanJMHaugenBR2004Retinoid X receptor-γ and peroxisome proliferator-activated receptor-γ expression predicts thyroid carcinoma cell response to retinoid and thiazolidinedione treatment. Molecular Cancer Therapeutics310111020.

    • Search Google Scholar
    • Export Citation
  • KrollTGSarrafPPecciariniLChenCJMuellerESpiegelmanBMFletcherJA2000PAX8–PPARγ1 fusion oncogene in human thyroid carcinoma. Science28913571360.

    • Search Google Scholar
    • Export Citation
  • LaemmliUK1970Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature227680685.

  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCt. Methods25402408.

    • Search Google Scholar
    • Export Citation
  • LoetscherMGerberBLoetscherPJonesSAPialiLClark-LewisIBaggioliniMMoserB1996Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. Journal of Experimental Medicine184963969.

    • Search Google Scholar
    • Export Citation
  • LombardiACantiniGPiscitelliEGelminiSFrancalanciMMelloTCeniEVaranoGFortiGRotondiM2008A new mechanism involving ERK contributes to rosiglitazone inhibition of tumor necrosis factor-alpha and interferon-γ inflammatory effects in human endothelial cells. Arteriosclerosis Thrombosis and Vascular Biology28718724.

    • Search Google Scholar
    • Export Citation
  • LusterAD1998Chemokines – chemotactic cytokines that mediate inflammation. New England Journal of Medicine338436445.

  • MackayCR1996Chemokine receptors and T cell chemotaxis. Journal of Experimental Medicine184799802.

  • MartelliMLIulianoRLe PeraISamaIMonacoCCammarotaSKrollTChiariottiLSantoroMFuscoA2002Inhibitory effects of peroxisome poliferator-activated receptor γ on thyroid carcinoma cell growth. Journal of Clinical Endocrinology and Metabolism8747284735.

    • Search Google Scholar
    • Export Citation
  • MarxNMachFSautyALeungJHSarafiMNRansohoffRMLibbyPPlutzkyJLusterAD2000Peroxisome proliferator-activated receptor-γ activators inhibit IFN-γ-induced expression of the T cell-active CXC chemokines IP-10, Mig, and I-TAC in human endothelial cells. Journal of Immunology16465036508.

    • Search Google Scholar
    • Export Citation
  • McCallKDHariiNLewisCJMalgorRKimWBSajiMKohnADMoonRTKohnLD2007High basal levels of functional Toll-like receptor 3 (TLR3) and noncanonical Wnt5a are expressed in papillary thyroid cancer and are coordinately decreased by phenylmethimazole together with cell proliferation and migration. Endocrinology14842264237.

    • Search Google Scholar
    • Export Citation
  • MelilloRMCastelloneMDGuarinoVDe FalcoVCiraficiAMSalvatoreGCaiazzoFBasoloFGianniniRKruhofferM2005The RET/PTC–RAS–BRAF linear signaling cascade mediates the motile and mitogenic phenotype of thyroid cancer cells. Journal of Clinical Investigation11510681081.

    • Search Google Scholar
    • Export Citation
  • OhtaKEndoTHaraguchiKHershmanJMOnayaT2001Ligands for peroxisome proliferator-activated receptor γ inhibit growth and induce apoptosis of human papillary thyroid carcinoma cells. Journal of Clinical Endocrinology and Metabolism8621702177.

    • Search Google Scholar
    • Export Citation
  • ParkJWZarnegarRKanauchiHWongMGHyunWCGinzingerDGLoboMCotterPDuhQYClarkOH2005Troglitazone, the peroxisome proliferator-activated receptor-γ agonist, induces antiproliferation and redifferentiation in human thyroid cancer cell lines. Thyroid15222231.

    • Search Google Scholar
    • Export Citation
  • PhilipsJCPetiteCWilliJPBucheggerFMeierCA2004Effect of peroxisome proliferator-activated receptor γ agonist, rosiglitazone, on dedifferentiated thyroid cancers. Nuclear Medicine Communications2511831186.

    • Search Google Scholar
    • Export Citation
  • PuxedduEKnaufJASartorMAMitsutakeNSmithEPMedvedovicMTomlinsonCRMorettiSFaginJA2005RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response. Endocrine-Related Cancer12319334.

    • Search Google Scholar
    • Export Citation
  • RomagnaniPRotondiMLazzeriELasagniLFrancalanciMBuonamanoAMilaniSVittiPChiovatoLTonaccheraM2002Expression of IP-10/CXCL10 and Mig/CXCL9 in the thyroid and increased serum levels of IP-10/CXCL10 in the serum of subjects with recent onset Graves'disease. American Journal of Pathology161195206.

    • Search Google Scholar
    • Export Citation
  • RuffiniPAMorandiPCabiogluNAltundagKCristofanilliM2007Manipulating the chemokine–chemokine receptor network to treat cancer. Cancer10923922394.

    • Search Google Scholar
    • Export Citation
  • SalvatoreGDe FalcoVSalernoPNappiTCPepeSTronconeGCarlomagnoFMelilloRMWilhelmSMSantoroM2006BRAF is a therapeutic target in aggressive thyroid carcinoma. Clinical Cancer Research1216231629.

    • Search Google Scholar
    • Export Citation
  • SchaeferKLDenevichSMaCCooleySRNakajimaAWadaKSchlezingerJSherrDSaubermannLJ2005Intestinal antiinflammatory effects of thiazolidenedione peroxisome proliferator-activated receptor-γ ligands on T Helper Type 1 chemokine regulation include nontranscriptional control mechanisms. Inflammatory Bowel Diseases11244252.

    • Search Google Scholar
    • Export Citation
  • SchmidIUittenbogaartCJamiesonBD2007Live-cell assay for detection of apoptosis by dual-laser flow cytometry using Hoechst 33342 and 7-amino-actinomycin D. Nature Protocols2187190.

    • Search Google Scholar
    • Export Citation
  • SchweppeREKlopperJPKorchCPugazhenthiUBenezraMKnaufJAFaginJAMarlowLACoplandJASmallridgeRC2008Deoxyribonucleic acid profiling analysis of 40 human thyroid cancer cell lines reveals cross-contamination resulting in cell line redundancy and misidentification. Journal of Clinical Endocrinology and Metabolism9343314341.

    • Search Google Scholar
    • Export Citation
  • TaubDDLloydARConlonKWangJMOrtaldoJRHaradaAMatsushimaKKelvinDJOppenheimJJ1993Recombinant human interferon-inducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells. Journal of Experimental Medicine17718091814.

    • Search Google Scholar
    • Export Citation
  • TowbinHStaehelinTGordonJ1979Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. PNAS7643504354.

    • Search Google Scholar
    • Export Citation
  • YangXYWangLHFarrarWL2008A role for PPARγ in the regulation of cytokines in immune cells and cancer. PPAR Research2008961753.