Abstract
Therapeutic options for patients with metastatic medullary thyroid carcinoma (MTC) are limited due to lack of effective treatments. Thus, there is a need to thoroughly characterize the pathways of molecular pathogenesis and to identify potential targets for therapy in MTC. Since epidermal growth factor receptor (EGFR) seems to play a crucial role for RET activation, a key feature of MTCs, and several promising EGFR/vascular endothelial growth factor receptor 2 (VEGFR2)-targeted drugs have been developed, the present study was designed to investigate whether these proteins are altered in MTCs. We used a well-characterized series of 153 MTCs to evaluate EGFR activation by sequencing and FISH analysis, and to perform EGFR and VEGFR2 immunohistochemistry. EGFR tyrosine kinase domain mutations were not a feature of MTCs; however, EGFR polysomy and a strong EGFR expression were detected in 15 and 13% of the tumors respectively. Interestingly, EGFR was significantly overexpressed in metastases compared with primary tumors (35 vs 9%, P=0.002). We also studied whether specific RET mutations were associated with EGFR status, and found a decrease in EGFR polysomies (P=0.006) and a tendency towards lower EGFR expression for the most aggressive RET mutations (918, 883). Concerning VEGFR2, metastasis showed a higher expression than primary tumors (P=2.8×10−8). In this first study investigating the relationship between EGFR, RET, and VEGFR2 in a large MTC series, we found an activation of EGFR and VEGFR2 in metastasis, using both independent and matched primary/metastasis samples. This suggests that some MTC patients may benefit from existing anti-EGFR/VEFGR2 therapies, although additional preclinical and clinical evidence is needed.
Introduction
Medullary thyroid carcinoma (MTC) arises from parafollicular C-cells and comprises 4–10% of all thyroid cancers ( Leboulleux et al. 2004). About 75% of cases are sporadic, and 25% are inherited as a component of the multiple endocrine neoplasia type 2 (MEN2A, MEN2B, and familial MTC (FMTC)) syndromes. The best treatment option for patients with MTC is total thyroidectomy and lymph node dissection, with an overall survival rate after 10 years of the primary surgery of 69%, and with age and disease extent at initial presentation as the main prognostic factors ( Bergholm et al. 1997). For local or regional recurrence in the neck and mediastinum, reoperation is the main treatment. However, cure is achieved only in 5–35% of the reoperated patients, and the remainder of patients are at high risk of developing distant metastasis ( Wells et al. 1982, Giraudet et al. 2007). Distant metastases that are observed at presentation in 7–23% of unselected patients with MTC are the main cause of MTC-related death with survival rates of 25% at 5 years after their detection ( Bergholm et al. 1997, Modigliani et al. 1998). To date, management of metastatic disease is primarily oriented towards the relief of symptoms, since no effective treatment exists. Thus, there is a great need for novel treatments and comprehensive clinical trials for patients with recurrent and metastatic MTC to improve therapy.
The RET proto-oncogene encodes a tyrosine kinase receptor that plays a major role in MTCs. Sporadic MTC forms are related to somatic mutations in the RET gene in 30–50% of these tumors ( Uchino et al. 1999), while the vast majority of FMTC forms carry inherited mutations of RET ( Schuffenecker et al. 1998, Randolph & Maniar 2000, Nagy et al. 2004). These are gain-of-function mutations and activate the kinase activity of RET, which provides mitogenic and survival signals to the calcitonin-producing C-cells. The type of RET mutation correlates with the presentation and aggressiveness of the tumor, thus allowing for genetic screening and recommendations for preventive surgical management in the familial cases ( Brandi et al. 2001, Cote & Gagel 2003).
In addition to RET, other kinase receptors may play a role in the development and progression of MTCs ( Liu et al. 2008). The epidermal growth factor receptor (EGFR) has been shown to be frequently overexpressed in various solid tumors, and plays a key role in cancer development and progression. Dimerization of the receptor following ligand binding results in transphosphorylation and subsequent activation of several downstream signal transduction pathways. Overexpression of EGF and EGFR has been detected in thyroid carcinomas, mainly in the extremely aggressive but rare anaplastic tumors. The inhibition of EGFR kinase activity by anti-EGFR antibodies and small molecule inhibitors has shown anti-proliferative effects in thyroid carcinoma cell lines in vitro and in vivo, including cells with activated RET mutants characteristic of sporadic and FMTCs ( Croyle et al. 2008). Furthermore, recent findings show that EGFR stimulates RET phosphorylation ( Croyle et al. 2008). All together, this suggests that EGFR might be important for the proliferation and metastasis of thyroid carcinoma and, in particular, of MTC. Recently, several EGFR-targeted molecules, such as the tyrosine kinase inhibitors, gefitinib and erlotinib, and the monoclonal antibody cetuximab, have been successfully used in the treatment of some EGFR-dependent cancers. The response rate to the novel EGFR-targeted drugs has been associated, among other factors, to the presence of somatic activating mutations in EGFR, to EGFR amplification/polysomy, and to EGFR protein overexpression ( Ciardiello & Tortora 2008, Zhang & Chang 2008). However, the potential benefit that these drugs could represent for MTCs has not been assessed, since the role of EGFR in MTCs has not been investigated. The only phase II trial evaluating the efficacy of an EGFR inhibitor (gefitinib) in patients with advanced thyroid cancer, included only four MTC patients ( Pennell et al. 2008), thus reflecting the enormous difficulty of studies on low incidence tumors, such as MTC, and the necessity of previous exploratory work as this one. Other tyrosine kinase receptors such as VEGFR2 have been associated with increased growth, progression, and invasiveness of papillary thyroid carcinoma (PTC; Klein et al. 1999). Thus, drugs with multiple targets, such as vandetanib that inhibits VEGFR2, RET and EGFR, could represent a promising therapeutic approach for MTC ( Wells et al. 2007, Haddad et al. 2008).
The present study was designed to investigate EGFR and VEGFR2 expression and activation in MTCs, using an outstanding series of 153 samples. We found that EGFR mutations in the tyrosine kinase domain are rare in MTC. On the other hand, EGFR expression was high and gene copy number increased in a substantial number of cases; metastases showed the highest EGFR and VEGFR2 expression. Overall, this is the first study that proves that EGFR and VEGFR2 are activated in a subset of MTCs, suggesting that these patients might benefit by novel drugs targeting these receptors.
Patients and methods
Human medullary thyroid carcinoma samples
A total of 153 paraffin-embedded MTC samples were available from the Pathology Departments of the Hospital Universitari Arnau de Vilanova, Hospital de Sant Pau, and the Spanish National Cancer Center. Institutional review board approval was obtained for the study, and informed consents were obtained from all patients. The patients were aged from 15 to 82 years (mean age 48 years) and 64% were females.
Of the 153 MTC samples, 133 corresponded to primary tumors and 20 corresponded to metastases ( Table 1), and in seven cases, primary/metastatic samples were from the same patient (Supplementary Table 1, which can be viewed online at http://erc.endocrinology-journals.org/supplemental/). The mutational status of the RET proto-oncogene in exons 10, 11, 13, 14, 15, and 16 was assessed from genomic DNA using standard PCR conditions, primers, and automated sequencing as previously described ( Ceccherini et al. 1993). The tumor samples corresponded to patients diagnosed as sporadic or familial based on the analysis of the RET proto-oncogene initially performed in peripheral blood samples. Familial cases carried germline mutations in exons 10, 11, 14, or 15, while sporadic cases carried somatic RET mutations in exons 10, 11, 15, or 16, or were classified as ‘no mutation in RET’ (RET negative) when no somatic mutations were found in the exons 10, 11, 13, 14, 15, or 16 ( Table 1). Among the apparently sporadic cases (without RET mutations in blood samples), 26 tumors were classified as ‘undetermined RET mutation’ due to failure of the PCR analysis caused by low tumoral DNA quality. Finally, only in three cases, the blood sample was not available and could not be classified as sporadic or familial (referred to as ‘unknown’).
Characteristics and mutational status of RET of the 153 medullary thyroid carcinoma (MTC) samples included in the study
| MTC samples | n |
|---|---|
| Primary tumor | 133 |
| Metastasis | 20 |
| Sporadic | 111 |
| RET exon 10 (C618, C620) | 2 |
| RET exon 11 (C634) | 5 |
| RET exon 15 (A883) | 1 |
| RET exon 16 (M918) | 28 |
| No mutation in RET a | 49 |
| Undetermined RET mutation b | 26 |
| Familial | 39 |
| RET exon 10 (C618, C620) | 5 |
| RET exon 11 (C634) | 31 |
| RET exon 14 (V804) | 2 |
| RET exon 15 (S891) | 1 |
| Unknown | 3 |
| RET exon 11 (C634) | 1 |
| Undetermined RET mutation b | 2 |
No mutations found in RET exons 10, 11, 13, 14, 15, and 16.
Tumors in which RET exons 10, 11, 13, 14, 15, or 16 could not be assessed.
Hematoxylin and eosin-stained sections of each sample were examined by a pathologist to confirm the diagnosis and to select MTC areas representative of each tumor to construct tissue microarrays (TMA). TMA construction was carried out as previously described with 2–3 cores of each tumor placed at different positions in the TMA and including, whenever possible, surrounding normal tissue ( Cascon et al. 2005). Three TMAs contained most of the tumor samples (109), and the remaining samples (44) were analyzed using whole tumor sections.
Immunohistochemical study of EGFR and VEGFR2 protein expression
The membranous protein expression of EGFR was determined by means of immunohistochemistry (IHC) using an EGFR monoclonal antibody (dil 1:10, EGFR.113, Novocastra) and the NovoLink Polymer Detection System (Novocastra, Newcastle upon Tyne, UK). Sections of the paraffin-embedded tissue were immersed in boiling 10 mM sodium citrate at pH 6.5 for 2 min in a pressure cooker for antigen retrieval. The results were analyzed by two experienced pathologists (X M-G and J P). The intensity of the staining was evaluated by visual examination under a microscope. Each case was scored by estimating the fraction of positively membrane-stained tumor cells (0, no staining was observed, or membrane staining was observed in <10% of the tumor cells; 1) a faint/barely perceptible membrane staining was detected in >10% of tumor cells. The cells exhibited incomplete membrane staining; 2) a weak to moderate complete membrane staining was observed in >10% of tumor cells; 3) a strong complete membrane staining was observed in >10% of tumor cells). The tumor was considered positive for EGFR expression when the score was 2+ or 3+. The IHC results obtained using the TMAs were validated independently in whole tumor sections from 20 samples (5 positive and 15 negative), and a complete agreement in the results was observed.
For VEGFR2 evaluation, TMA blocks were sectioned at a thickness of 3 μm and dried for 16 h at 56 °C. They were dewaxed in xylene, rehydrated through a graded ethanol series, and washed with PBS. Antigen retrieval was achieved by heat treatment in a pressure cooker for 3 min in 10 mM citrate buffer (pH 6.5). Endogenous peroxidase was blocked. A monoclonal antibody from Santa Cruz Biotechnology (Santa Cruz, CA, USA) (clon A3, dilution 1/100) was used. This primary antibody was incubated overnight at 4 °C in a humidified chamber. The reaction was visualized with the EnVision Detection Kit (DAKO, Glostrup, Denmark) using diaminobenzidine chromogen as substrate. Sections were counterstained with Harris hematoxylin. Immunohistochemical results were evaluated by three different members of the team (X M-G, E C, and J P). The staining was cytoplasmic. Uniform pre-established criteria were used to assign an intensity score ( Pallares et al. 2006). Immunoreactivity was graded semi-quantitatively by considering the percentage and intensity of the staining of the tumor cells. A histological score was obtained from each sample, which ranged from 0 (no immunoreaction) to 300 (maximum immunoreactivity). The score was obtained by applying the following formula: H score=1X (% light staining)+2X (% moderate staining)+3X (% strong staining). Since each TMA included two different tumor cylinders from each case, immunohistochemical evaluation was done after examining both samples.
EGFR gene copy number analysis by FISH
Fluorescence in situ hybridization (FISH) studies were performed with a commercial probe for EGFR (Kreatch Cat # KBI-10702 EGFR, Her1 (7p11)/SE 7, Amsterdam, The Netherlands). This probe labeled the EGFR locus with a red fluorochrome and the centromere of chromosome 7 that served as a ploidy control, with a green fluorochrome. The laboratory process was performed following the recommendations of the manufacturer. The slides were observed under an Olympus BX fluorescence microscope, and cell images were captured using a CCD camera (Photometrics SenSys, Tucson, AZ, USA) connected to a computer running the Chromofluor image analysis system (Cytovision, v3.1. software package, Applied Imaging Corporation, San Jose, CA, USA). Nonoverlapping tumor cell nuclei were analyzed to estimate the number of red (EGFR) and green (CEP7) signals. FISH scoring of EGFR fluorescence signals was carried out in each sample by counting the number of red and green signals in an average of 100 nuclei. Since no EGFR gene amplifications were found, we assigned the level of ploidy for each sample as follows: tumors with four or more copies of EGFR and their respective centromeres in ≥40% of the cells were considered to be FISH positive for polysomy, whereas tumors with the majority of cells carrying two or three copies of EGFR were considered to be FISH negative for polysomy. The FISH results obtained in the TMAs were validated independently in sections for eight samples (four positive and four negative), and a complete agreement in the results was observed.
Detection of mutations in the tyrosine kinase-coding domain of the EGFR gene
Genomic DNA was extracted from paraffin-embedded tumor tissue using the DNA easy tissue kit (Qiagen). EGFR exons 18, 19, and 21 were selected for mutational analysis because most functional mutations cluster in this region (encoding the tyrosine kinase domain; Sharma et al. 2007), and were amplified by nested PCR using specific primers: exon 18 (f-PCR1 CAAATGAGCTGGCAAGTGCCGTGTC, r-PCR1 GAGTTTCCCAAACACTCAGTGAAAC; f-PCR2 CAAGTGCC GTGTCCTGGCACCCAAGC, r-PCR2 CCAAACACTCAGTGAAACAAAGAG); exon 19 (f-PCR1 GCAATATCAGCCTTAGGTGCGGCTC, r-PCR1 CATAGAAAGTGAACATTTAGGATGTG, f-PCR2 GTGCATCGCTGGTAACATCC, r-PCR2 TGTGGAGATGAGCAGGGTCT); and exon 21 (f-PCR1 CTAACGTTCGCCAGCCATAAGTCC, r-PCR1 GCTGCG ACTCACCCAGAATGTCTGG, f-PCR2 GCTCAGAGCCTGGCATGAA, r-PCR2 CATCCTCCCCTGCATGTGT). After purification of the PCR products, direct DNA sequencing was performed (sequencer 3730, Applied Biosystems, Alcobendas, Madrid, Spain).
Statistical analysis
All statistical analyses were performed using SPSS (Chicago, IL, USA) version 17.0 statistical software. The χ2 test was used to compare variables representing tumor types (primary tumors/metastasis and sporadic/familial), EGFR IHC and FISH data (positive/negative samples). For RET mutations analysis, we considered independently each mutation type according to activation (very high: 918 and 883; high: 634 and 618; moderated: 620, 804, and 891; and no RET mutation). Unconditional lineal regression was applied for the comparison of the continuous variable VEGFR2 IHC with all other variables. P values <0.05 were considered significant.
Results
Immunohistochemical, gene copy number, and mutational study of EGFR in MTCs
From the 153 MTCs available for the study, 17 cases were not evaluable for EGFR IHC analysis. MTCs exhibited a variable immunopositivity for EGFR ( Fig. 1A and B): 18 cases (13%) presented a high membranous EGFR expression (eight cases scored 3+ and ten cases scored 2+), while in 118 cases the expression of EGFR was absent or very limited (92 cases scored 0 (68%) and 26 scored 1+(19%) respectively). EGFR overexpression (2–3+) was compared with the characteristics of the tumor, finding a statistically significant difference between primary tumors and metastases (P=0.002). Strong EGFR positivity occurred in 9% of the primary tumors versus 35% of the metastases ( Table 2). On the other hand, the sporadic/familial character of the tumors did not have an influence on EGFR IHC.
MTCs show variability in EGFR and VEGFR2 protein expression and EGFR gene copy number. EGFR and VEGFR2 protein expression was analyzed by IHC. Lack of membrane staining corresponded to EGFR-negative cases (A), while strong EGFR staining corresponded to positive cases (B). Representative cases with low (C) and high (D) VEGFR2 protein expression. The number of EGFR gene copies was analyzed by FISH analysis. Diploid tumor cells showed two red signals (EGFR), and two green (CEP7) signals in most cells (E), whereas cells with high polysomy showed four or more red and green signals in more than 40% of the tumor cells (F).
Citation: Endocrine-Related Cancer 17, 1; 10.1677/ERC-08-0304
Epidermal growth factor receptor (EGFR) protein expression (immunohistochemistry, IHC) and polysomy (fluorescence in situ hybridization, FISH) according to the type of medullary thyroid carcinoma
| EGFR | Primary n (%) | Metastasis n (%) | P value | Sporadic n (%) | Familial n (%) | P value |
|---|---|---|---|---|---|---|
| IHC negative (0/1) a | 105 (91) | 13 (65) | 0.002 | 90 (89) | 25 (78) | NS |
| IHC positive (2/3) | 11 (9) | 7 (35) | 11 (11) | 7 (22) | ||
| FISH negative b | 83 (87) | 11 (79) | NS | 66 (84) | 27 (90) | NS |
| FISH positive | 13 (13) | 3 (21) | 13 (16) | 3 (10) |
EGFR immunohistochemistry was considered positive for strong membrane staining (scores 2+ and above), and negative for absent or very limited expression (scores 0 and 1+).
FISH positive referred to EGFR polysomy, and FISH negative referred to lack of polysomy.
We then determined the number of copies of the EGFR gene in the MTCs by FISH analysis ( Fig. 1E and F). No gene amplifications were found, but some tumors showed an elevated number of copies (four or more) detected by both the EGFR and centromeric probes. This was interpreted as polysomy for chromosome 7 and was observed in 16 samples (14%), whereas 94 samples (86%) were negative (the remaining 43 cases were not evaluable). EGFR polysomy was similar in metastasis and primary tumors, and in sporadic versus familial disease ( Table 2). However, as was expected, there was a significant correlation between EGFR gene polysomy and strong (2/3+) EGFR protein expression (P=0.011), with 37% of the FISH-positive cases having a strong IHC signal, whereas 12% of the FISH-negative cases had a strong EGFR IHC signal (Supplementary Table 2, which can be viewed online at http://erc.endocrinology-journals.org/supplemental/).
We also determined whether the EGFR gene might be carrying activating mutations in the tyrosine kinase domain in MTCs, using tumoral DNA and sequencing those EGFR exons where the mutations cluster in non-small cell lung cancer. The most frequently mutated exon 19 was analyzed in 58 cases, and exons 21 and 18 in 17 and 16 cases respectively. We found only one case carrying two exon 19 nucleotide changes not described before and of unknown significance (P741H and I759V).
RET mutational status and EGFR expression and copy number
Since it has been shown that EGFR contributes to RET kinase activation, which is a key event in all familial and most sporadic MTCs, we investigated whether EGFR expression or gene copy number could be related to specific RET mutations. MTCs were grouped according to the aggressiveness of the RET mutation (i.e. very high: 918 and 883; high: 634 and 618; moderate: 620, 804, and 891; and no RET mutation, when no mutations were found in RET exons 10, 11, 13, 14, 15, and 16), and this was compared with the EGFR IHC and FISH data.
When the sporadic and familial character of the MTCs was not taken into account in the analysis, EGFR expression and EGFR polysomy in MTCs were not significantly associated to specific RET mutations. However, there seemed to be a tendency toward a lower proportion of EGFR IHC positive cases among the tumors with the most aggressive mutations (4.2% RET 918/883 mutated tumors were 2+/3 IHC versus 18% of the rest of RET-mutated tumors, and 14% of the negative tumors; see Supplementary Table 3, which can be viewed online at http://erc.endocrinology-journals.org/supplemental/). When we performed this analysis subdividing the MTCs into sporadic and familial cases, we found that in the sporadic forms, EGFR polysomy was negatively correlated with the most aggressive RET 918/883 mutations. In the primary sporadic tumors, only 9.1% (2/22) of the MTCs carrying RET 918/883 mutations had EGFR polysomy, in contrast to 57% (4/7) of the other cases carrying less aggressive RET mutations (804, 891, 620, 618, and 634), P=0.006 (Supplementary Table 3). When metastatic cases were included in the study, the differences remained significant (P=0.016). With respect to the RET-negative tumors, 13% (3/23) had EGFR polysomy (Supplementary Table 3). In familial tumors, no RET 918/883 cases were available for the study, and in less aggressive RET mutants, only 7% (2/29) showed EGFR polysomy, suggesting that the familiar or sporadic context in which the mutation appears is important for EGFR copy number.
Immunohistochemical study of VEGFR2
VEGFR2 protein expression in the MTC was evaluated by IHC ( Fig. 1C and D). The expression of VEGFR2 was higher in the metastases compared with the primary tumors with a very significant P value (P=2.8×10−8, see Fig. 2A). In addition, we found greater VEGFR2 IHC staining in: sporadic cases (P=0.030), RET mutation-negative tumors (P=0.008), and tumors without RET 634/618 mutations (P=0.012). When performing a multivariate analysis including all significant variables, only the metastatic nature remained as an independent feature associated to VEGFR2 IHC. To further analyze these variables, we performed the analysis only in the primary cases. We found that the presence of RET 634/618 mutations was negatively associated to VEGFR2 IHC (P=0.036; Fig. 2B). These results suggest that in addition to metastatic/primary characteristics, mutations affecting RET residues 634/618 could also be predictors of VEGFR2 protein expression.
VEGFR2 protein expression in MTC. VEGFR2 protein expression was analyzed by IHC. Both hereditary and sporadic tumors were included in the analysis. Metastasis showed a significantly higher VEGFR2 protein expression than primary tumors, P=2.8×10−8 (A). Analysis of RET mutations in MTC primary tumors showed that the presence of RET 634/618 mutations was negatively associated with VEGFR2 IHC (P=0.036) (B).
Citation: Endocrine-Related Cancer 17, 1; 10.1677/ERC-08-0304
No statistically significant association between VEGFR2 IHC and EGFR IHC, or EGFR copy number was found. However, 25% of the metastases simultaneously showed a strong EGFR (2/3+) and VEGFR2 (within the 25% top intensity score) expression. Among the primary tumors, none of the cases showed simultaneously a strong expression of these proteins (Supplementary Table 1).
EGFR and VEGFR2 protein expression changes during metastasis
We were able to collect matched primary tumor/metastasis from the same individual in seven cases, allowing us to determine whether EGFR and VEGFR2 status changed during this progression. With respect to EGFR, we found that in four cases, the expression was the same in primary tumor and metastasis, but three cases exhibited an increased EGFR expression in the corresponding metastasis. In two cases, the expression greatly increased from very weak expression (1+) to strong (2+), and in one case, the expression changed from absence of protein (0) to weak expression (1+) in the metastasis ( Table 3). With respect to the EGFR FISH analysis, we could only obtain the results of five pairs: three of them were negative in the primary tumor and in the metastasis, while two cases, coincident with those showing increased EGFR expression, acquired polysomy in the metastatic stage ( Table 3). VEGFR2 protein expression increased more than 1.5-fold in three cases, two of them also showing an increase in EGFR expression and copy number. Two cases showed a moderate increase and two showed a moderate decrease in VEGFR2 expression in the corresponding metastasis ( Table 3).
Epidermal growth factor receptor (EGFR) expression and copy number and VEGFR2 expression in primary tumors and metastasis from the same patient
| EGFR IHC | EGFR FISH | VEGFR2 IHC | |||||
|---|---|---|---|---|---|---|---|
| Matched MTC tumors | Primary | Metastasis | Primary | Metastasis | Primary | Metastasis | Fold change |
| 87-10505/88-1607 | 1+ | 2+ | Neg | Polysomy | 100 | 200 | 2.0 |
| 07B8365/07B8386 | 1+ | 2+ | Neg | Polysomy | 120 | 180 | 1.5 |
| 83-8179/83-8179-6C | 0 | 1+ | NE | NE | 190 | 235 | 1.2 |
| 91-8321-2RA/91-91-10971 | 2+ | 2+ | Neg | Neg | 95 | 190 | 2.0 |
| 01B6049-3/01B6049-2 | 1+ | 1+ | Neg | Neg | 220 | 255 | 1.2 |
| 05B7152-4/05B7152 | 1+ | 1+ | Neg | Neg | 180 | 135 | 0.8 |
| 06T197.1/06T197.2 | 0 | 0 | Neg | NE a | 230 | 200 | 0.9 |
Not evaluable. Bold indicates significant increases.
Discussion
Surgery is the only curative treatment of MTC, and unfortunately, 10–15% of sporadic and index familial cases present at diagnosis a palpable thyroid nodule, which is related to cervical lymph node metastases, and in some cases, distant metastases affecting most frequently lungs, bones and liver. In retrospective series, survival rates when distant metastases have already occurred at diagnosis are around 25% at 5 years and 10% at 10 years, since there is no effective treatment. The RET oncogene plays a crucial role in thyroid tumorigenesis, with somatic RET rearrangements being a prevalent feature of PTCs, whereas activating germline point mutations are responsible for MEN2-associated MTCs and somatic mutations for sporadic MTCs. Similarly, the tyrosine kinase receptor EGFR is associated with the regulation of cell growth, proliferation, and apoptosis. Croyle et al. (2008) recently showed that EGFR and RET coimmunoprecipitate and that ligand-induced activation of EGFR results in phosphorylation of RET. In addition, several EGFR inhibitors have been shown to markedly inhibit the growth of the MTC cell line TT, carrying the C634W RET mutation, and of RET-transfected cell lines expressing C634W and M918T mutated RET ( Croyle et al. 2008). These data suggest that EGFR status determination in MTCs might be crucial for a possible EGFR-targeted therapy for these tumors. In addition, VEGFR2 has been associated with increased growth, progression, and invasiveness of PTC ( Klein et al. 1999), and drugs simultaneously inhibiting VEGFR2, RET and EGFR have been developed and have promising therapeutic results in MTC ( Wells et al. 2007, Haddad et al. 2008). However, the expression and activation of EGFR and VEGFR2 have not been investigated in MTCs. This is the first study providing this data in MTC, by using a large well-characterized panel of primary and metastatic samples.
With respect to EGFR and VEGFR2 protein expression, strong EGFR expression was found in 13% of all MTCs studied, with metastases having higher positivity than primary tumors (P=0.002, Table 2). Similarly, VEGFR2 was overexpressed in metastasis compared with primary tumors (P=2.8×10−8, Fig. 2). This was supported by primary/metastasis-matched cases from the same individual, where some tumors showed that EGFR and VEGFR2 overexpression developed during this progression ( Table 3). In agreement with this, EGFR and VEGFR2 overexpression has been shown to be closely correlated to advanced tumor stage, metastasis, and poor clinical outcome in several human cancers. With respect to thyroid carcinomas, EGFR overexpression has been detected in most anaplastic tumors ( Schiff et al. 2004, Lee et al. 2007, Wiseman et al. 2007, Elliott et al. 2008) and to a much lower extent in PTCs ( Schiff et al. 2004, Murakawa et al. 2005, Mitsiades et al. 2006, Lim et al. 2007, Elliott et al. 2008). In PTC, EGFR expression has been associated to poor prognosis ( Akslen & Varhaug 1995, Chen et al. 1999), although not always ( Lim et al. 2007), and recent studies have suggested that EGFR inhibitors might be active against anaplastic thyroid carcinomas ( Lopez et al. 2008). In thyroid neoplasias, overexpression of VEGF and platelet-derived growth factor receptor have been described, and disruption of VEGF signaling has been shown to inhibit thyroid cancer cell growth in vitro and in vivo ( Tuttle et al. 2002, Turner et al. 2003, Lin & Chao 2005, Vieira et al. 2005).
With respect to the number of EGFR gene copies in the MTCs, we did not detect amplifications but found polysomies in 15% of the tumors examined. FISH positivity was not significantly different among primary and metastatic tumors, although there was a tendency towards higher positivity in metastases (21 and 13% positivity for metastasis and primary tumors respectively, Table 2). EGFR copy numbers were independent of the familial/sporadic origin of the tumors. When comparing IHC and FISH results, there was not a complete agreement between EGFR protein expression and gene copy number, but as expected, there was a significant correlation (P=0.01). This is similar to the findings in anaplastic thyroid carcinoma (ATC) and follicular thyroid carcinoma (FTC), where EGFR gene amplification did not occur, but polysomy was detected with high frequency (46–61 and 32% respectively; Lee et al. 2007, Liu et al. 2008), and there was also a significant, although not complete correlation between IHC and FISH positivity in ATCs ( Lee et al. 2007). Concerning EGFR mutations, none of the already described EGFR tyrosine kinase activating mutations were detected in the subset of MTCs studied, only two not previously described amino acid changes with unknown biological significance were found in one of the samples. These results are similar to those described for ATC and FTC in which no mutations were found ( Lee et al. 2007, Liu et al. 2008).
Since RET activation seems to be influenced by EGFR ( Croyle et al. 2008), we investigated whether EGFR activation could be related to specific RET mutations by comparing EGFR IHC and FISH results with the RET mutation of the MTCs. Depending on the location and the amino acids affected, the point mutations correlated with the presentation and aggressiveness of the tumor. We found that the tumors with the most aggressive RET mutations (in codons 883/918) had a significantly lower number of EGFR polysomies and a tendency toward less EGFR immunopositivity when compared with the other RET mutations. It could be speculated that the most aggressive RET mutations are less dependent on EGFR activation. In fact, in the work by Fagin et al. ( Croyle et al. 2008) in which RET codon 634 and codon 918 mutated cell lines are compared, the effect of EGFR inhibitors on the 918 mutated cell line seems smaller, in agreement with our data. Since EGFR activation status seems related to RET activation, we examined EGFR status in the RET-negative tumors. However, we found no differences in EGFR activation between RET-positive and -negative tumors, probably indicating that other molecular mechanisms leading to RET activation, such as RET gene copy gains, altered promoter activity, or increased transcription, might be actuating in the RET mutation-negative tumors. Additionally, and although it is unclear whether VEGFR2 and RET are related, when we analyzed VEGFR2 expression in our series, a modest significant association with RET mutation status in primary tumors was found ( Fig. 2B).
In conclusion, in our MTC series, we found a significant overexpression of VEGFR2 and EGFR in metastasis, and we provide evidence showing EGFR polysomy in a subset of MTC. This data suggests that therapies targeting these tyrosine kinase receptors could have a clinical impact on these patients. In fact, promising results with MTC have been reported with vandetanib, an antagonist of VEGFR, EGFR, and RET ( Wells et al. 2007, Haddad et al. 2008). In conclusion, this is the first study including a large series of well-characterized MTCs that shows that EGFR and VEGFR2 participate in the progression of an important proportion of cases.
Declaration of interest
There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by grants from the Fundación Mutua Madrileña, FIS (Fondo de Investigaciones Sanitarias; PI080883), by a grant from ISCIII CIBERER (Center for Biomedical Research on Rare Diseases), and RTICC (RD06/0020/1034). Tumor samples were obtained from Xarxa catalana de Bancs de Tumors and the Tumor Banc Platform of RTICC.
References
Akslen LA & Varhaug JE 1995 Oncoproteins and tumor progression in papillary thyroid carcinoma: presence of epidermal growth factor receptor, c-erbB-2 protein, estrogen receptor related protein, p21-ras protein, and proliferation indicators in relation to tumor recurrences and patient survival. Cancer 76 1643– 1654.
Bergholm U, Bergstrom R & Ekbom A 1997 Long-term follow-up of patients with medullary carcinoma of the thyroid. Cancer 79 132– 138.
Brandi ML, Gagel RF, Angeli A, Bilezikian JP, Beck-Peccoz P, Bordi C, Conte-Devolx B, Falchetti A, Gheri RG & Libroia A et al. 2001 Guidelines for diagnosis and therapy of MEN type 1 and type 2. Journal of Clinical Endocrinology and Metabolism 86 5658– 5671.
Cascon A, Ruiz-Llorente S, Rodriguez-Perales S, Honrado E, Martinez-Ramirez A, Leton R, Montero-Conde C, Benitez J, Dopazo J & Cigudosa JC et al. 2005 A novel candidate region linked to development of both pheochromocytoma and head/neck paraganglioma. Genes, Chromosomes and Cancer 42 260– 268.
Ceccherini I, Bocciardi R, Luo Y, Pasini B, Hofstra R, Takahashi M & Romeo G 1993 Exon structure and flanking intronic sequences of the human RET proto-oncogene. Biochemical and Biophysical Research Communications 196 1288– 1295.
Chen BK, Ohtsuki Y, Furihata M, Takeuchi T, Iwata J, Liang SB & Sonobe H 1999 Co-overexpression of p53 protein and epidermal growth factor receptor in human papillary thyroid carcinomas correlated with lymph node metastasis, tumor size and clinicopathologic stage. International Journal of Oncology 15 893– 898.
Ciardiello F & Tortora G 2008 EGFR antagonists in cancer treatment. New England Journal of Medicine 358 1160– 1174.
Cote GJ & Gagel RF 2003 Lessons learned from the management of a rare genetic cancer. New England Journal of Medicine 349 1566– 1568.
Croyle M, Akeno N, Knauf JA, Fabbro D, Chen X, Baumgartner JE, Lane HA & Fagin JA 2008 RET/PTC-induced cell growth is mediated in part by epidermal growth factor receptor (EGFR) activation: evidence for molecular and functional interactions between RET and EGFR. Cancer Research 68 4183– 4191.
Elliott DD, Sherman SI, Busaidy NL, Williams MD, Santarpia L, Clayman GL & El-Naggar AK 2008 Growth factor receptors expression in anaplastic thyroid carcinoma: potential markers for therapeutic stratification. Human Pathology 39 15– 20.
Giraudet AL, Vanel D, Leboulleux S, Auperin A, Dromain C, Chami L, Ny Tovo N, Lumbroso J, Lassau N & Bonniaud G et al. 2007 Imaging medullary thyroid carcinoma with persistent elevated calcitonin levels. Journal of Clinical Endocrinology and Metabolism 92 4185– 4190.
Haddad RI, Krebs AD, Vasselli J, Paz-Ares LG & Robinson B 2008 A phase II open-label study of vandetanib in patients with locally advanced or metastatic hereditary medullary thyroid cancer. Journal of Clinical Oncology 26 6024.
Klein M, Picard E, Vignaud JM, Marie B, Bresler L, Toussaint B, Weryha G, Duprez A & Leclere J 1999 Vascular endothelial growth factor gene and protein: strong expression in thyroiditis and thyroid carcinoma. Journal of Endocrinology 161 41– 49.
Leboulleux S, Baudin E, Travagli JP & Schlumberger M 2004 Medullary thyroid carcinoma. Clinical Endocrinology 61 299– 310.
Lee DH, Lee GK, Kong SY, Kook MC, Yang SK, Park SY, Park SH, Keam B, Park do J & Cho BY et al. 2007 Epidermal growth factor receptor status in anaplastic thyroid carcinoma. Journal of Clinical Pathology 60 881– 884.
Lim DJ, Baek KH, Lee YS, Park WC, Kim MK, Kang MI, Jeon HM, Lee JM, Yun-Cha B & Lee KW et al. 2007 Clinical, histopathological, and molecular characteristics of papillary thyroid microcarcinoma. Thyroid 17 883– 888.
Lin JD & Chao TC 2005 Vascular endothelial growth factor in thyroid cancers. Cancer Biotherapy & Radiopharmaceuticals 20 648– 661.
Liu Z, Hou P, Ji M, Guan H, Studeman K, Jensen K, Vasko V, El-Naggar AK & Xing M 2008 Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. Journal of Clinical Endocrinology and Metabolism 93 3106– 3116.
Lopez JP, Wang-Rodriguez J, Chang CY, Sneh G, Yu MA, Pardo FS, Aguilera J & Ongkeko WM 2008 Gefitinib (Iressa) potentiates the effect of ionizing radiation in thyroid cancer cell lines. Laryngoscope 118 1372– 1376.
Mitsiades CS, Kotoula V, Poulaki V, Sozopoulos E, Negri J, Charalambous E, Fanourakis G, Voutsinas G, Tseleni-Balafouta S & Mitsiades N 2006 Epidermal growth factor receptor as a therapeutic target in human thyroid carcinoma: mutational and functional analysis. Journal of Clinical Endocrinology and Metabolism 91 3662– 3666.
Modigliani E, Cohen R, Campos JM, Conte-Devolx B, Maes B, Boneu A, Schlumberger M, Bigorgne JC, Dumontier P & Leclerc L et al. 1998 Prognostic factors for survival and for biochemical cure in medullary thyroid carcinoma: results in 899 patients. The GETC Study Group. Groupe d'etude des tumeurs a calcitonine. Clinical Endocrinology 48 265– 273.
Murakawa T, Tsuda H, Tanimoto T, Tanabe T, Kitahara S & Matsubara O 2005 Expression of KIT, EGFR, HER-2 and tyrosine phosphorylation in undifferentiated thyroid carcinoma: implication for a new therapeutic approach. Pathology International 55 757– 765.
Nagy R, Sweet K & Eng C 2004 Highly penetrant hereditary cancer syndromes. Oncogene 23 6445– 6470.
Pallares J, Rojo F, Iriarte J, Morote J, Armadans LI & de Torres I 2006 Study of microvessel density and the expression of the angiogenic factors VEGF, bFGF and the receptors Flt-1 and FLK-1 in benign, premalignant and malignant prostate tissues. Histology and Histopathology 21 857– 865.
Pennell NA, Daniels GH, Haddad RI, Ross DS, Evans T, Wirth LJ, Fidias PH, Temel JS, Gurubhagavatula S & Heist RS et al. 2008 A phase II study of gefitinib in patients with advanced thyroid cancer. Thyroid 18 317– 323.
Randolph GW & Maniar D 2000 Medullary carcinoma of the thyroid. Cancer Control 7 253– 261.
Schiff BA, McMurphy AB, Jasser SA, Younes MN, Doan D, Yigitbasi OG, Kim S, Zhou G, Mandal M & Bekele BN et al. 2004 Epidermal growth factor receptor (EGFR) is overexpressed in anaplastic thyroid cancer, and the EGFR inhibitor gefitinib inhibits the growth of anaplastic thyroid cancer. Clinical Cancer Research 10 8594– 8602.
Schuffenecker I, Virally-Monod M, Brohet R, Goldgar D, Conte-Devolx B, Leclerc L, Chabre O, Boneu A, Caron J & Houdent C et al. 1998 Risk and penetrance of primary hyperparathyroidism in multiple endocrine neoplasia type 2A families with mutations at codon 634 of the RET proto-oncogene. Groupe D'etude des Tumeurs a Calcitonine. Journal of Clinical Endocrinology and Metabolism 83 487– 491.
Sharma SV, Bell DW, Settleman J & Haber DA 2007 Epidermal growth factor receptor mutations in lung cancer. Nature Reviews. Cancer 7 169– 181.
Turner HE, Harris AL, Melmed S & Wass JA 2003 Angiogenesis in endocrine tumors. Endocrine Reviews 24 600– 632.
Tuttle RM, Fleisher M, Francis GL & Robbins RJ 2002 Serum vascular endothelial growth factor levels are elevated in metastatic differentiated thyroid cancer but not increased by short-term TSH stimulation. Journal of Clinical Endocrinology and Metabolism 87 1737– 1742.
Uchino S, Noguchi S, Yamashita H, Sato M, Adachi M, Yamashita H, Watanabe S, Ohshima A, Mitsuyama S & Iwashita T et al. 1999 Somatic mutations in RET exons 12 and 15 in sporadic medullary thyroid carcinomas: different spectrum of mutations in sporadic type from hereditary type. Japanese Journal of Cancer Research 90 1231– 1237.
Vieira JM, Santos SC, Espadinha C, Correia I, Vag T, Casalou C, Cavaco BM, Catarino AL, Dias S & Leite V 2005 Expression of vascular endothelial growth factor (VEGF) and its receptors in thyroid carcinomas of follicular origin: a potential autocrine loop. European Journal of Endocrinology 153 701– 709.
Wells SA Jr, Baylin SB, Johnsrude IS, Harrington DP, Mendelsohn G, Ontjes DJ & Cooper CW 1982 Thyroid venous catheterization in the early diagnosis of familial medullary thyroid carcinoma. Annals of Surgery 196 505– 511.
Wells SA, Gosnell JE, Gagel RF, Moley JF, Pfister DG, Sosa JA, Skinner M, Krebs A, Hou J & Schlumberger M 2007 Vandetanib in metastatic hereditary medullary thyroid cancer: follow-up results of an open-label phase II trial. Journal of Clinical Oncology 25 6018.
Wiseman SM, Masoudi H, Niblock P, Turbin D, Rajput A, Hay J, Bugis S, Filipenko D, Huntsman D & Gilks B 2007 Anaplastic thyroid carcinoma: expression profile of targets for therapy offers new insights for disease treatment. Annals of Surgical Oncology 14 719– 729.
Zhang X & Chang A 2008 Molecular predictors of EGFR-TKI sensitivity in advanced non-small cell lung cancer. International Journal of Medical Sciences 5 209– 217.
