Allelic variant at −79 (C>T) in CDKN1B (p27Kip1) confers an increased risk of thyroid cancer and alters mRNA levels

in Endocrine-Related Cancer

The aim of this study is to assess if common genetic variants located in the CDKN1B locus, coding for the cell cycle inhibitor p27Kip1, are involved in thyroid cancer susceptibility. Based on the literature and functional predictions, we selected three polymorphisms within the CDKN1B gene (rs2066827 (T326G, V109G), rs34330 (−79C>T) and rs36228499 (−838C>A)) to perform the first case–control study in thyroid cancer involving this locus. We had 649 Spanish patients with sporadic thyroid cancer and 385 healthy representative controls available. Luciferase reporter gene assays, real-time quantitative reverse transcription-PCR and immunoblot experiments were carried out to demonstrate the putative effect of the associated variant. The polymorphism rs34330 (−79C>T) was identified as a risk factor for developing the follicular variant of papillary thyroid carcinoma (FVPTC), fitting a recessive model (odds ratio=2.12; 95% confidence interval=1.09–4.15; P value=0.023). The risk allele (T) of this single nucleotide polymorphism led to a lower transcription rate in cells transfected with a luciferase reporter driven by the polymorphic p27Kip1 promoter (P value <0.001). This effect was observed in −79TT genotype control carriers, who showed a tendency towards lower CDKN1B mRNA levels in lymphocytes, as well as at the protein level. This is the first study that identifies CDKN1B as a low-penetrance gene in thyroid cancer, and specifically in FVPTC subtype. We propose a reduced CDKN1B gene transcription depending on the genotype of the −79C>T (rs34330) variant as a novel mechanism underlying p27Kip1 downregulation.

Abstract

The aim of this study is to assess if common genetic variants located in the CDKN1B locus, coding for the cell cycle inhibitor p27Kip1, are involved in thyroid cancer susceptibility. Based on the literature and functional predictions, we selected three polymorphisms within the CDKN1B gene (rs2066827 (T326G, V109G), rs34330 (−79C>T) and rs36228499 (−838C>A)) to perform the first case–control study in thyroid cancer involving this locus. We had 649 Spanish patients with sporadic thyroid cancer and 385 healthy representative controls available. Luciferase reporter gene assays, real-time quantitative reverse transcription-PCR and immunoblot experiments were carried out to demonstrate the putative effect of the associated variant. The polymorphism rs34330 (−79C>T) was identified as a risk factor for developing the follicular variant of papillary thyroid carcinoma (FVPTC), fitting a recessive model (odds ratio=2.12; 95% confidence interval=1.09–4.15; P value=0.023). The risk allele (T) of this single nucleotide polymorphism led to a lower transcription rate in cells transfected with a luciferase reporter driven by the polymorphic p27Kip1 promoter (P value <0.001). This effect was observed in −79TT genotype control carriers, who showed a tendency towards lower CDKN1B mRNA levels in lymphocytes, as well as at the protein level. This is the first study that identifies CDKN1B as a low-penetrance gene in thyroid cancer, and specifically in FVPTC subtype. We propose a reduced CDKN1B gene transcription depending on the genotype of the −79C>T (rs34330) variant as a novel mechanism underlying p27Kip1 downregulation.

Introduction

Cancers that arise in the thyroid gland account for 1% of all neoplasias. More than 95% of thyroid carcinomas are derived from follicular cells or thyrocytes, the thyroid hormone-producing cell lineage in the gland (DeLellis 2004). Among the neoplasias arising from thyroid follicular cells, ‘papillary thyroid carcinoma’ (PTC) and ‘follicular thyroid carcinoma’ (FTC) represent the two most common subtypes (85 and 10% respectively; Kondo et al. 2006). A minority of the thyroid tumours (3%), referred to as ‘medullary thyroid carcinoma’ (MTC), arise from a different cell lineage, the parafollicular or C-cells, which are involved in calcitonin secretion (Randolph & Maniar 2000). Different genetic alterations, all of them involving the RET/MAP kinase pathway, have been described as subtype-specific somatic causal changes in PTC and FTC (Santoro et al. 1990, Greco et al. 1992, Davies et al. 2002, Nikiforov 2002, Kondo et al. 2006). Although some genes related to thyroid cancer development as part of familial syndromes are known (Mulligan et al. 1993, Hofstra et al. 1994), there are few data on genetic risk factors related to the susceptibility for developing sporadic thyroid carcinomas (Cebrian et al. 2005, Ruiz-Llorente et al. 2007). The identification of low-penetrance genes (LPGs) related to follicular cell-derived carcinoma is an arduous task due to the heterogeneity and relative rarity of the disease. A well-known approach, which compensates this problem and increases the probability of finding genetic risk factors related to the disease, is the selection of single nucleotide polymorphisms (SNPs) within candidate genes or loci for the development of thyroid cancer.

The CDKN1B gene encodes p27Kip1, an inhibitor of the cyclin/cyclin-dependent kinase (Cdk) complexes (Sa et al. 2005), which are essential for cell cycle progression. Loss of expression of p27Kip1 protein has been described as a frequent event in several human cancers (Slingerland & Pagano 2000, Chu et al. 2008), apparently conferring a proliferative advantage that can lead to tumour formation. This behaviour first suggested a tumour suppressor role of p27Kip1, but it does not fit all classic features, since it is rarely mutated in cancer (Kawamata et al. 1995, Kossatz & Malek 2007, Lindberg et al. 2007). Alternative mechanisms acting at the post-transcriptional level have been suggested, including a lower translation rate of CDKN1B mRNA (Hengst & Reed 1996); an increase in protein degradation, specifically by the Scf-Skp2 E3 ubiquitin-protein ligase (Pagano et al. 1995, Chiappetta et al. 2007); and the cytosolic mislocalization of p27Kip1 protein (Viglietto et al. 2002, Min et al. 2004).

CDKN1B plays a key role in the aetiology of thyroid cancer. Several lines of evidence from clinical and in vitro studies demonstrate that somatic loss, underexpression (Khoo et al. 2002) or mislocalization (Baldassarre et al. 1999) of p27Kip1 may contribute to the process of thyroid carcinogenesis. In addition, it has been demonstrated that the phosphatidyl-inositol-3-kinase (PI3K)/AKT pathway controls thyroid cell proliferation by regulating the expression and subcellular localization of p27 (Baldassarre et al. 1999, Khoo et al. 2002, Motti et al. 2005), and therefore, CDKN1B (p27Kip1) represents a good candidate gene for a classical case–control study. In view of these antecedents, the aim of the present study was to assess whether common, potentially functional, genetic variants within the CDKN1B gene could influence the risk for thyroid cancer. Thus, based on a scan of the literature and the use of bioinformatics tools, three potentially functional SNPs in the CDKN1B gene were selected: −838C>A (rs36228499), −79C>T (rs34330) and 326T>G (V109G, rs2066827).

Here, we propose that the −79C>T (rs34330) polymorphism acts as a genetic risk factor for thyroid cancer by affecting the transcription rate, as indicated by the functional assays performed in this study.

Subjects and methods

Patients

A total of 649 Spanish patients with sporadic thyroid cancer were recruited for a multicentre hospital-based study. The main thyroid cancer subtypes were represented in this series: 274 MTC, 328 PTC, composed of 193 ‘classic PTC’ (cPTC) and 129 ‘follicular variant PTC’ (FVPTC), and 47 FTC. Diagnoses were assessed by pathologists from the different institutions that participated in the study.

Controls

We selected a series of 385 healthy, representative Spanish controls, all of them cancer free and without any thyroid pathology, according to their responses to a general clinical questionnaire.

Mean age and gender distribution were similar in controls and cases (Mann–Whitney's U and Kruskal–Wallis associated P values >0.05).

Informed consent was obtained from all subjects included in the study.

DNA and RNA isolation

Genomic DNA was extracted from the blood of 591 patients following a standard method (Sambrook et al. 1989). The remaining 58 DNA samples were obtained from patients' saliva using the Oragene DNA Self-Collection Kit (DNA Genotek, Ottawa, Ontario, Canada). Control DNAs were isolated from peripheral blood lymphocytes using automatic DNA extraction according to the manufacturer's instructions (Magnapure, Roche).

Total RNA was isolated from lymphocytes of 97 controls following the standard TRIzol Reagent method (Invitrogen).

SNP selection

Fifteen CDKN1B polymorphisms are described in the International HapMap Project database (http://www.hapmap.org/, release 21a/phaseII), considering the region that spans from 5 kb upstream to 1 kb downstream of the gene. We applied two filters in the SNP selection: the allele frequency (at least a minor allele frequency (MAF) of 0.05 in the HapMap-CEU population) and a predicted functionality. Seven of the fifteen variants passed the first filter, and only three of these (−838C>A (rs36228499), −79C>T (rs34330) and 326T>G (V109G, rs2066827)) showed consistent functional predictions (at least two different algorithms predicted the same result) according to the PupaSuite (Conde et al. 2006) and F-SNP (Lee & Shatkay 2008) bioinformatics tools. Nucleotide positions are numbered relative to the start of translation according to the Genbank accession number AB003688. Predicted functionality was reinforced by previously published data as described below. The −838C>A lies within the promoter region of p27Kip1, and it has been associated with an increased risk of myocardial infarction (Gonzalez et al. 2004). The −79C>T is a polymorphism within the 5′ untranslated region (5′ UTR) of p27Kip1, which has been shown to contain promoter activity (Minami et al. 1997, Ito et al. 1999, Liu et al. 2005), and has been previously associated with cancer (Chang et al. 2004, Wang et al. 2007a, Driver et al. 2008). Finally, 326T>G (V109G) is a non-synonymous variant in exon 1, which has been also associated with susceptibility to cancer (Kibel et al. 2003, Li et al. 2004, Gayther et al. 2007).

According to the HapMap, there is some linkage disequilibrium along the CDKN1B region between rs36228499 and rs34330, but they do not show a high correlation. Thus, the three mentioned SNPs were assessed as independent putative genetic risk factors.

Genotyping platforms

Two different genotyping strategies were used to evaluate the three polymorphisms: a TaqMan genotyping assay (Applied Biosystems, CA, USA) for SNPs rs34330 and rs2066827, and a restriction fragment length polymorphism (RFLP) approach for rs36228499.

Taqman platform

Probe accuracy to discriminate the two alleles at a specific locus was initially checked in a set of 24 DNA samples. Genotyping specificity was assessed by including two DNA duplicates and a negative control in each 96-well plate genotyped, yielding 100% consistent replication results. In addition, we genotyped cases and controls in the same run. The reaction was performed at the default conditions recommended by the manufacturer: an initial denaturing step of 10 min at 95 °C, followed by 40 cycles of 15 s of denaturation at 92 °C, and 1 min of annealing and extension at 60 °C. Samples without a genotype call under these conditions were excluded for further analyses.

RFLP technique

rs36228499 was genotyped as described by Gonzalez et al. (2004). To improve the amplification intensity and, thus, the assay resolution, we designed a nested PCR, using the following primer sequences and PCR conditions: first PCR: −838_F: 5′-GACCTTCGCGGTCCTCTG-3′; −838_R: 5′-GTGACTGCTGGAGGGGTACT-3′; temperature of annealing, Ta=58 °C, 40 cycles; second PCR: −838N_F: 5′-TCCAGGTCCCGGCTTCCCGGt-3′; −838N_R: 5′-CCTGCTCTGGCTGGCCTCGGAG-3′; Ta=65 °C, 35 cycles. The −838N_F primer included a mismatch (shown in lower case) to create a TaqI restriction endonuclease site when −838C was present. Amplicons were subsequently digested by TaqI (Fermentas, Burlington, Ontario, Canada), and the products were separated in a 3.5% agarose D1 medium (Pronadisa, Torrejón de Ardoz Spain) gel electrophoresis run (data not shown). Enzymatic digestion yielded fragments of 173 bp (undigested, corresponding to the polymorphic AA genotype), 152+21 bp (digested, wild-type CC genotype) or both (CA heterozygotes).

DNA sequencing

Accuracy of both TaqMan and RFLP genotyping was confirmed by direct sequencing of randomly selected samples that represented 5% of the total samples. Regions containing the studied SNPs were amplified by PCR prior to sequencing using the following additional primers and conditions: −79_F: 5′-CCATTTGATCAGCGGAGACT-3′; −79_R: 5′-CACTCGCACGTTTGACATCT-3′; Ta=58 °C, for −79C>T; and 109_F: 5′-AAGAGTTAACCCGGGACTT-3′; 109_R: 5′-CTCTCCCAAAGCTAAATCAG-3′, Ta=56 °C, to interrogate the V109G variant. DNA sequencing was carried out using an ABI 3730xl sequencer (Applied Biosystems).

Construction of p27Kip1 reporter vector

The −79C>T SNP lies within the promoter/5′ UTR of the CDKN1B gene. Therefore, we cloned the minimal regulatory region of the CDKN1B gene that has been shown to be able to efficiently drive transcription of a downstream reporter gene (Minami et al. 1997, Ito et al. 1999, Liu et al. 2005). DNA fragments from the 5′ region of the CDKN1B gene between nucleotides −575 and −1 (AB003688), containing either C or T at position −79, were generated through PCR using genomic DNA of homozygous CC and TT individuals with forward (GGTACCGGTACCCCACCTTAAGGCCGCGCTCG) and reverse (AAGCTTAAGCTTCTTTCTCCCGGGTCTGCACG) primers containing KpnI and HindIII sites respectively. PCR products were cloned into the pGL3-Basic promoterless plasmid (Promega) to generate pGL3-p27Kip1C (−79C) and pGL3-p27Kip1T (−79T) in order to drive the expression of the downstream luciferase gene. Plasmids generated for each genotype were confirmed by direct sequencing.

Cell culture and transfections

HeLa cells (American Type Culture Collection, Manassas, VA, USA) were incubated at 37 °C in a humidified 5% CO2–95% O2 atmosphere in DMEM – high glucose medium (Sigma–Aldrich) supplemented with 100 U/ml penicillin, 0.1 mg/ml streptomycin and 10% foetal bovine serum. The rat thyroid cell line PCCl3 was cultured in F-12 Coon's medium (Euroclone, Pero-Milano, Italy) supplemented with 100 U/ml penicillin, 0.1 mg/ml streptomycin, 5% newborn calf serum, 20 ng/ml glycyl-histidyl-lysine (GHL; Sigma), 3.6 ng/ml hydrocortisone (Sigma), 10 μg/ml insulin from bovine pancreas (Sigma), 5 μg/ml human apo-transferrin (Sigma), 10 ng/ml somatostatin (Sigma) and 0.5 mU/ml TSH (Sigma). Transfections were performed with Trans lT-LT1 Transfection Reagent (Mirus, Madison, WI, USA) following the manufacturer's protocol.

Luciferase reporter gene assays

For luciferase activity assays, cells were transfected with 1 μg of the promoter/luciferase reporter gene (pGL3-p27Kip1C or pGL3-p27Kip1T), with 100 ng of pRL Renilla as the control vector (Promega) to correct for differences in transfection efficiency. Cells were collected 24 and 48 h after transfection by centrifugation, washed twice with PBS and lysed with 100 μl of cell lysis reagent (Dual-Luciferase Reporter Assay System, Promega). Cell lysates were dispensed into luminometer plates, followed by sequential auto-injection of the Luciferase Assay Reagent for firefly luciferase activity measurement, and Stop & Glo Reagent for Renilla luciferase activity measurement (Dual-Luciferase Reporter Assay System, Promega). Basal luciferase activity was checked in cells transfected with an empty vector (pGL3 Basic Vector). Three independent transfections were performed for each construct (pGL3 Basic Vector, pGL3-p27Kip1C or pGL3-p27Kip1T) in triplicate.

cDNA synthesis and real-time quantitative reverse transcription-PCR

We obtained cDNA from RNA that was isolated from lymphocytes of 97 healthy volunteers. We used it to evaluate the genotype–phenotype correlation by means of real-time quantitative PCR (qPCR) to compare the CDKN1B mRNA levels as a function of rs34330 polymorphism genotype. One microgram of total RNA was reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen) and an oligo dT18 primer following the manufacturer's instructions. The amount of CDKN1B mRNA was quantified by real-time PCR with the Sequence Detection System 7900HT (Applied Biosystems) using the specific primers (p27QF: 5′-CCCTAGAGGGCAAGTACGAGT-3′ and p27QR: 5′-AGTAGAACTCGGGCAAGCTG-3′), a labelled probe (Universal ProbeLibrary #39, Roche), and the Universal Master Mix (PE Applied Biosystems). The amplification conditions consisted of an initial step at 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Standard curves were generated with serial 1:4 dilutions of a sample showing high CDKN1B expression of mRNA. Normalization was carried out with the internal standard β-glucuronidase (GUS) using as a forward primer 5′-GAAAATATGTGGTTGGAGAGCTCATT-3′; as a reverse primer 5′-CCGAGTGAAGATCCCCTTTTTA-3′; and as a probe 5′-FAM-CCAGCACTCTCGTCGGTGACTGTTCA-3BQ1-3′. All reactions were in the initial part of the exponential amplification phase, and the cycle at which each sample crossed the threshold (Ct) was recorded for CDKN1B and GUS. The ΔΔCt method was used for the calculation of the different amounts of mRNA (Livak & Schmittgen 2001). Negative controls were included in all PCRs, and assays were carried out in triplicate.

Protein isolation and immunoblot

Nine healthy volunteers carrying rs34330 genotypes equally (CC, CT and TT, three each) were randomly selected to check whether this promoter variant could have an effect at the p27Kip1 protein level. Whole protein extraction from blood lymphocytes was performed using RIPA (Invitrogen) buffer according to the manufacturer's recommendations.

Proteins were separated by 12% SDS-PAGE using the XCell SureLock Mini-Cell electrophoresis system (Invitrogen), and were transferred to polyvinylidene fluoride membranes (Immobilon-P Membrane, Millipore, Billerica, MA, USA). Equal loading of proteins was verified by Ponceau S staining. The membranes were blocked, and were then incubated with a 1:500 dilution of the sc-776 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) following the manufacturer's instructions. This is a commercial polyclonal antibody raised against amino acids 1–197 representing full-length p27Kip1. After washing, the membranes were incubated with a 1:10 000 dilution of Alexa Fluor 680 anti-rabbit IgG (Molecular Probes, Eugene, OR, USA) secondary antibody, and the corresponding fluorescence signal was visualized using a LI-COR Odyssey Blot scanner. Equal protein loading was assessed by using a 1:1000 dilution of anti-α-tubulin (DM1A; Abcam, Cambridge, UK).

Protein quantification was done using Odyssey 2.1 software. Both p27Kip1 and α-tubulin (αTUB) band intensities were corrected by subtracting the intensities of their respective backgrounds. Final p27Kip1 expression was represented as relative units, resulting from p27Kip1/αTUB protein intensity ratios.

Statistical analysis

Departure from Hardy–Weinberg equilibrium (HWE) for all SNPs was tested in the controls using Fisher's exact test (command available online at http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl). Associations between each SNP and thyroid cancer risk were assessed using Pearson's χ2 test. Genotype frequencies in cases and controls were compared, and odds ratios (ORs) were estimated directly from contingency tables using homozygotes of the more frequent allele in controls as the reference group. For each SNP, the best fitting model was determined by parsimony based on the corresponding associated P values.

When the unadjusted P value was found to be significant, further analyses were performed to adjust for putative confounding factors such as age and gender. Age was recodified as a new variable using the mean as the cut-off value. Mantel–Haenszel test was performed stratifying by gender and age. OR homogeneity was also tested by executing Tarone's test. Finally, stepwise conditional logistic regression method was used to discard age and gender as confounders.

For analyses of luciferase assays, comparisons between means were performed using Student's t-test. We used Mann–Whitney's U test to compare medians from qPCR assays by genotype.

Statistical tests were performed using SPSS for Windows 11.0 and GraphStat programs.

Results

Polymorphism rs34330 (−79C>T) is significantly associated with the FVPTC

The −838C>A (rs36228499), −79C>T (rs34330) and 326T>G (V109G, rs2066827) SNPs among the available Spanish cases and controls were genotyped to determine whether a significant association existed between them and thyroid cancer. Controls fulfilled HWE for all three SNPs (Table 1).

Table 1

CDKN1B polymorphisms and samples genotyped

Polymorphisms selectedNumber of samples (n) genotyped in each groupa
SNP (nucleotide change)LocationMajor/minor allele (MAF)Controls (HWEb)MTCPTCcPTCFVPTCFTC
rs2066827 (T326G)Exon 1 V109GT/G (0.20)334 (0.27)24431318110025
rs34330 (−79C>T)5′ UTR/promoterC/T (0.21)385 (1.00)27432817812947
rs36228499 (−838C>A)PromoterC/A (0.46)c296 (0.64)17832619310823

MAF, minor allele frequency; MTC, medullary thyroid carcinoma; PTC, papillary thyroid carcinoma; cPTC, classic PTC; FVPTC, follicular variant of PTC; FTC, follicular thyroid carcinoma.

Samples without a genotype call were excluded.

Hardy–Weinberg equilibrium P value in controls.

In our control series (no data available in public databases).

While V109G and −838C>A variants did not show significant associations with any of the thyroid cancer subtypes analyzed, rs34330 (−79C>T) was identified as a risk factor for developing the FVPTC. According to these results, the polymorphic TT genotype of rs34330 was significantly overrepresented in FVPTC patients. The variant fit a recessive model (OR=2.12; 95% confidence interval (CI)=1.09–4.15; P value=0.023; Tables 2 and 3).

Table 2

Thyroid cancer risk and rs34330 (−79C>T) genotype

Codominant modelRecessive model
CC versus CTCC versus TT(CC+CT) versus TT
GroupnORa95% CIORa95% CIORa95% CIP valuesb
Controls385
MTC2741.000.72–1.380.930.48–1.820.930.49–1.790.834 NS
PTC3280.960.70–1.321.440.81–2.561.460.83–2.560.186 NS
cPTC1780.910.63–1.331.050.51–2.181.090.53–2.230.819 NS
FVPTC1291.080.70–1.652.201.10–4.382.121.09–4.150.023a
FTC471.390.75–2.590.780.17–3.490.670.15–2.920.590 NS

OR, odds ratio; CI, confidence interval; MTC, medullary thyroid carcinoma; PTC, papillary thyroid carcinoma; cPTC, classic PTC; FVPTC, follicular variant of PTC; FTC, follicular thyroid carcinoma.

OR obtained by comparing cases against controls and considering T as the risk allele.

The P values are derived from the recessive model.

Table 3

Risks estimated for the CDKN1B polymorphisms genotyped in the follicular variant of papillary thyroid carcinoma (FVPTC)

Codominant modelRecessive model
WW versus WMWW versus MM(WW+WM) versus MM
SNP (location)Minor (MAF)FVPTC (n)ORa95% CIORa95% CIORa95% CIP valuesb
rs36228499 (−838C>A)A (0.46)1081.000.55–1.791.160.61–2.191.160.72–1.870.544 NS
rs34330 (−79C>T)T (0.21)1291.080.70–1.652.201.10–4.382.121.09–4.150.023a
rs2066827 (T326G)G (0.20)1000.800.50–1.281.240.52–2.981.370.58–3.200.474 NS

W, wild-type allele; M, minor allele; MAF, minor allele frequency; OR, odds ratio; CI, confidence interval.

OR obtained by comparing cases against controls and considering the minor allele (M) as the risk allele.

The P values are derived from the recessive model.

The previous association remained statistically significant after correcting for gender and age. We first proved that OR remained homogeneous (P value >0.05) by Tarone's test. Then, we demonstrated that neither gender nor age was acting as a confounding factor in our results by both Mantel–Haenszel test and stepwise conditional logistic regression, which yielded an adjusted OR=2.01 and P value=0.041.

Polymorphism −79C>T decreases CDKN1B transcription rate in luciferase assays

Since the CDKN1B −79TT genotype was associated with a statistically significant increased risk in FVPTC patients, we sought to determine whether the −79C>T genetic variation had functional consequences for p27Kip1 expression.

In a first set of experiments, we determined the transcriptional capacity of the two CDKN1B variant promoters by transfecting the pGL3 Basic Vector, pGL3-p27Kip1C and pGL3-p27Kip1T plasmids into HeLa cells. After 48 h in the presence or absence of serum, cells were collected and the transcriptional activity of the two promoter variants was determined by luciferase assay (Fig. 1A). We observed that the transcriptional activity shown by the variant promoter (p27Kip1T) was significantly lower than that shown by the wild-type promoter (p27Kip1C), both in the presence (P value=0.001) and absence (P value=0.002) of serum.

Figure 1
Figure 1

Transcriptional activity of constructs driven by the CDKN1B gene promoter containing the −79C or T allelic variant in HeLa cells. (A) The transcriptional activity of the pGL3-p27Kip1C and pGL3-p27Kip1T constructs in HeLa cells was evaluated in the presence or absence of serum. Luciferase activity was normalized to the internal Renilla control, after subtraction of pGl3D Basic Vector activity. Data represent the means±s.d. of three independent transfections. (B) Cell cycle-dependent transcriptional activity of the pGL3-p27Kip1C and pGL3-p27Kip1T constructs in HeLa cells. HeLa cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T constructs, and were subsequently starved in serum-free medium for 24 h. Cells were induced to re-enter the cell cycle by the addition of fresh medium supplemented with 10% FCS for 0, 12 and 24 h. At these time points, the cells were harvested, lysed and analyzed for luciferase activity.

Citation: Endocrine-Related Cancer 17, 2; 10.1677/ERC-09-0016

Then, we determined the activity of the different variants of the p27 promoter. To this end, HeLa cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T constructs and starved. Starved cells were induced to re-enter the cell cycle by serum administration, and were analyzed for luciferase activity after 0, 12 and 24 h. After normalizing luciferase activity for the internal Renilla control, the average transcriptional activity of pGL3-p27Kip1T was consistently lower (by about 50%) than that of pGL3-p27Kip1C (Fig. 1B). The activity of the wild-type CDKN1B promoter (pGL3-p27Kip1C) increased in mid-G1 (12 h after serum administration) and decreased at the G1/S transition (24 h after serum administration), whereas the mutant p27 promoter (pGL3-p27Kip1T) showed similar kinetics but significantly reduced transcriptional activity (P value0 h=0.002, P value12 h<0.001 and P value24 h<0.001 respectively).

Subsequently, we analyzed the activity of the p27 promoter in thyrocytes. To this end, we used PCCl3 cells, an established, differentiated rat cell line, as a model of thyroid cells. PCCl3 cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T, placed in a medium with or without TSH for 24 and 48 h, and analyzed for luciferase activity. After normalizing luciferase activity for the internal Renilla control, the average transcriptional activity of pGL3-p27Kip1T in thyrocytes was ∼50% compared with that of pGL3-p27Kip1C (P values <0.001; Fig. 2). Interestingly, the difference in the transcriptional activity of the two promoter variants was more evident when the cells were deprived of TSH.

Figure 2
Figure 2

Transcriptional activity of constructs driven by the CDKN1B gene promoter containing the −79C or T allelic variant in rat thyroid cells. Rat thyroid PCCl3 cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T constructs, and were subsequently placed in TSH-devoid (panel A) or complete medium (panel B). Cells were collected after 24 and 48 h, and luciferase activity was determined as described. Luciferase activity was normalized to the internal Renilla control after subtraction of pGl3D Basic Vector activity. Data represent the means±s.d. of three independent transfections.

Citation: Endocrine-Related Cancer 17, 2; 10.1677/ERC-09-0016

The −79TT risk genotype exhibits diminished CDKN1B mRNA levels and a tendency towards lower protein levels in lymphocytes from control individuals

To confirm the in vitro data from the transfection experiments, we evaluated CDKN1B mRNA expression by real-time quantitative reverse transcription-PCR in lymphocytes from a series of 97 healthy controls with known −79C>T variant genotype. Genotypic frequencies in this subset were CC=0.59, CT=0.36 and TT=0.05, which were similar to the frequencies exhibited by the HapMap-CEU population. The mean Ct values obtained for CDKN1B and GUS were 29.4 and 27.7 respectively. We observed a marginal statistically significant difference between the average CDKN1B mRNA expression of the CC and TT genotypes (P value=0.069, Fig. 3A). This tendency was also observed when we clustered the non-risk CC and CT genotypes, and compared them against the TT risk group (P value=0.102, Fig. 3B). These findings further suggest that the −79TT genotype is associated with decreased CDKN1B mRNA expression.

Figure 3
Figure 3

Differential expression of CDKN1B in human lymphocytes, depending on −79C>T (rs34330) genotype. (A) CDKN1B mRNA levels in lymphocytes from 97 control individuals, depending on the genotype of the promoter −79C>T polymorphism. Data points represent the average normalized mRNA amounts from three measurements for each sample, assessed by real-time quantitative RT-PCR. Horizontal bars represent the mean value for each genotype group. (B) CDKN1B mRNA levels of CC+CT against TT carrier individuals show a significant difference between these groups, which backs up the recessive model proposed.

Citation: Endocrine-Related Cancer 17, 2; 10.1677/ERC-09-0016

In addition, immunoblot experiments were performed to further check this downregulation, which suggest a modest effect of −79C>T-dependent p27Kip1 regulation at the protein level in lymphocytes (Fig. 4).

Figure 4
Figure 4

Immunoblot experiment assessing p27Kip1 protein levels in human lymphocytes, depending on −79C>T (rs34330) genotype. (A) Immunoblot evaluating the rs34330-dependent expression of p27Kip1 in whole-cell lysates from healthy volunteers' lymphocytes. Fifty micrograms of proteins were loaded in each lane. Equal loading was verified using α-tubulin as a reference. (B) p27Kip1 protein expression depending on −79C>T genotype. A trend towards lower p27Kip1 protein levels in −79TT carriers against non-risk genotypes (CC+CT) was observed. p27Kip1 protein levels are given in relative units (RU), and they resulted from the correction of p27Kip1 expression with α-tubulin levels in each case (p27Kip1/αTUB ratio).

Citation: Endocrine-Related Cancer 17, 2; 10.1677/ERC-09-0016

Discussion

This is the first association study to investigate the effects of common genetic polymorphisms of the cell cycle regulator gene CDKN1B (p27Kip1) in thyroid cancer. Regression analysis allowed us to determine that the SNP rs34330 (−79C>T), located in CDKN1B promoter, was significantly associated with the FVPTC under a recessive model (OR=2.12; P value=0.023). Furthermore, the functional assays designed to analyze its effect indicated that this SNP plays a role in CDKN1B transcription. This finding is of special relevance because although p27Kip1 has been widely studied in tumours (Slingerland & Pagano 2000, Chu et al. 2008) and specifically in thyroid cancer (Erickson et al. 1998, Tallini et al. 1999, Vitagliano et al. 2004), attention has been focused so far on p27Kip1 translation, degradation and mislocalization. Here, we report for the first time a differential transcription rate of CDKN1B depending on a genetic variant located in its promoter.

The polymorphism rs34330 has been previously associated with some other neoplasias. Chang et al. (2004) described an association of this SNP with hereditary prostate cancer. They reported that the C allele of the variant was over-transmitted from parents to their affected offspring. They also suggested that the polymorphism was able to disrupt a CpG site, a supposition that has not been demonstrated so far.

Moreover, a two-step large-scale association study, involving more than 2200 patients and more than 2200 controls, found the same variant to be associated with an increased risk of breast cancer in the British population (Driver et al. 2008). They described the same risk genotype (TT) reported here, also fitting a recessive model (OR=1.22; P value=0.013).

In another recent study, this variant was related to the risk of lung cancer (OR=1.27; 95% CI=1.01–1.60; Wang et al. 2007a), and it was especially strong among heavy smokers (OR=6.24; 95% CI=1.67–23.34). The authors proposed that due to the location of this SNP, its functional effect might be associated with a reduced p27Kip1 protein production. Indeed, they remarked that the SNP was located in the 5′ UTR, where Millard et al. (2000) had described a ‘U-rich element’ that may bind several factors (HuR, hnRNP C1 and C2) involved in mRNA stability, processing and translation. However, the polymorphism rs34330 lies 27 nucleotides upstream of the consensus U-rich element defined by Millard et al. This fact, along with some contradictory in silico predictions that we obtained for the above-mentioned binding factors (data not shown), leads us to believe that this is not the mechanism underlying the observed SNP effect.

We hypothesized that rs34330 could alter CDKN1B transcription. In fact, two independent tools (CONSITE and TFSEARCH), based on different algorithms and integrated into the F-SNP database (Lee & Shatkay 2008), predicted that rs34330 is located within an important transcription factor binding site. Moreover, both tools predicted a differential affinity, and thus binding, of the human transcription factors AP-2α and SP1 to the variant sequences. Especially, for the first factor, binding is predicted to be strongly influenced by the presence of the polymorphism.

The foregoing predictions were backed by a regulation mechanism described for some genes, which contain overlapping AP-2 and SP1 DNA-binding sites (Hilger-Eversheim et al. 2000). In these cases, gene transcription is regulated by the SP1/AP-2 ratio. This is of special interest, keeping in mind that AP-2α is known to bind CDKN1Ap21/cip1 (Zeng et al. 1997), a gene encoding a cell cycle inhibitor that belongs to the same family as CDKN1Bp27/Kip1. Overall, it is tempting to speculate that the above factors contribute to the functional effect of the polymorphism at least in the FVPTC, but specific functional studies focused on these factors will be necessary to prove this hypothesis.

The functional assays performed in the present study provide sufficient evidence to conclude that rs34330 (−79C>T) significantly influences CDKN1B transcription rates.

Thus, it should be considered as an alternative mechanism of p27Kip1 downregulation in thyroid cancer, independently of the precise transcription factors involved.

Regarding the two polymorphisms that were not found to be associated with thyroid cancer in the present study, there are no studies directly assessing the influence of rs36228499 (−838C>A) in cancer. Only a study by Spurdle et al. (2009) provides indirect evidence that this SNP, tagged by the neighbouring polymorphism rs3759216, does not modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. In contrast with the −838 variant, there are numerous studies that found a significant association between the CDKN1B-coding SNP rs2066827 (V109G) and cancer. Among them, those related to advanced prostate cancer (Kibel et al. 2003), oral squamous cell carcinoma (Li et al. 2004), invasive epithelial ovarian cancer (Gayther et al. 2007), high-grade breast tumours (Tigli et al. 2005) and lymph node metastasis in breast cancer (Naidu et al. 2007) are worth mentioning. However, our data, based on a large Spanish population, suggest that this amino acid change in p27Kip1 is not associated with any of the subtypes of thyroid cancer.

Taken together, we suggest that CDKN1B acts as a LPG in thyroid cancer, specifically associated with FVPTC. We propose that the −79C>T transition (rs34330) is the causal variant of a differential transcriptional expression of CDKN1B. These conclusions are supported by the following observations: a significant association in this first case–control study performed in thyroid cancer (risk genotype TT overrepresented in FVPTC; OR=2.12, P value=0.023); the absence of a high correlation with neighbouring SNPs around this polymorphism, and the non-significant results for rs2066827 and rs36228499, which minimize the possibility of alternative variants being the causal ones; and the functional assays carried out show a tendency towards lower expression of CDKN1B in the presence of the risk genotype (TT) of rs34330, at both mRNA and protein levels. These findings point to an alternative downregulation mechanism of p27Kip1, which should be further explored in the cancer field.

Although these results have to be replicated in independent, representative and well-characterized thyroid cancer series, we propose the SNP rs34330, located in the CDKN1B promoter, as a genetic risk factor related to susceptibility for developing FVPTC. A biological explanation could be that the genetic alterations characterizing FVPTC are similar to those described in FTC, and are therefore related to the PI3K/Akt pathway. Regarding this, there are several genetic evidences suggesting that dysregulated PI3K/Akt pathway plays a significant role in the pathogenesis of thyroid tumours, particularly FTC (Hou et al. 2007, Riesco-Eizaguirre & Santisteban 2007, Wang et al. 2007b, Liu et al. 2008). Since p27Kip1 belongs to this pathway, an alteration in CDKN1B transcription rate caused by rs34330 could be of fundamental importance in these tumours.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from FIS (Fondo de Investigaciones Sanitarias), reference PI080883 (to M Robledo), from Fundación Mutua Madrileña, reference AP2775/2008 (to M Robledo), and from the Italian Association for Cancer Research (AIRC) and PRIN 2006061439 from MIUR to G Viglietto. D Malanga and C De Marco were supported by fellowships from FIRC. I Landa, C Montero-Conde and L J Leandro-García are supported by fellowships from FIS. L Inglada-Pérez is supported by CIBERER.

Acknowledgements

We thank Alessandra Di Gennaro for the technical support.

References

  • BaldassarreGBellettiBBruniPBocciaATrapassoFPentimalliFBaroneMVChiappettaGVentoMTSpieziaS1999Overexpressed cyclin D3 contributes to retaining the growth inhibitor p27 in the cytoplasm of thyroid tumor cells. Journal of Clinical Investigation104865874.

    • Search Google Scholar
    • Export Citation
  • CebrianALesueurFMartinSLeylandJAhmedSLuccariniCSmithPLLubenRWhittakerJPharoahPD2005Polymorphisms in the initiators of RET (rearranged during transfection) signaling pathway and susceptibility to sporadic medullary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism9062686274.

    • Search Google Scholar
    • Export Citation
  • ChangBLZhengSLIsaacsSDWileyKETurnerALiGWalshPCMeyersDAIsaacsWBXuJ2004A polymorphism in the CDKN1B gene is associated with increased risk of hereditary prostate cancer. Cancer Research6419971999.

    • Search Google Scholar
    • Export Citation
  • ChiappettaGDe MarcoCQuintieroACalifanoDGherardiSMalangaDScrimaMMontero-CondeCCitoLMonacoM2007Overexpression of the S-phase kinase-associated protein 2 in thyroid cancer. Endocrine-Related Cancer14405420.

    • Search Google Scholar
    • Export Citation
  • ChuIMHengstLSlingerlandJM2008The Cdk inhibitor p27 in human cancer: prognostic potential and relevance to anticancer therapy. Nature Reviews. Cancer8253267.

    • Search Google Scholar
    • Export Citation
  • CondeLVaquerizasJMDopazoHArbizaLReumersJRousseauFSchymkowitzJDopazoJ2006PupaSuite: finding functional single nucleotide polymorphisms for large-scale genotyping purposes. Nucleic Acids Research34W621W625.

    • Search Google Scholar
    • Export Citation
  • DaviesHBignellGRCoxCStephensPEdkinsSCleggSTeagueJWoffendinHGarnettMJBottomleyW2002Mutations of the BRAF gene in human cancer. Nature417949954.

    • Search Google Scholar
    • Export Citation
  • DeLellis RA 2004 Pathology and Genetics of Tumours of Endocrine Organs. Lyon: IARC Press.

  • DriverKESongHLesueurFAhmedSBarbosa-MoraisNLTyrerJPPonderBAEastonDFPharoahPDDunningAM2008Association of single-nucleotide polymorphisms in the cell cycle genes with breast cancer in the British population. Carcinogenesis29333341.

    • Search Google Scholar
    • Export Citation
  • EricksonLAJinLWollanPCThompsonGBvan HeerdenJLloydRV1998Expression of p27kip1 and Ki-67 in benign and malignant thyroid tumors. Modern Pathology11169174.

    • Search Google Scholar
    • Export Citation
  • GaytherSASongHRamusSJKjaerSKWhittemoreASQuayeLTyrerJShadforthDHogdallEHogdallC2007Tagging single nucleotide polymorphisms in cell cycle control genes and susceptibility to invasive epithelial ovarian cancer. Cancer Research6730273035.

    • Search Google Scholar
    • Export Citation
  • GonzalezPDiez-JuanACotoEAlvarezVRegueroJRBatallaAAndresV2004A single-nucleotide polymorphism in the human p27kip1 gene (−838C>A) affects basal promoter activity and the risk of myocardial infarction. BMC Biology25.

    • Search Google Scholar
    • Export Citation
  • GrecoAPierottiMABongarzoneIPagliardiniSLanziCDella PortaG1992TRK-T1 is a novel oncogene formed by the fusion of TPR and TRK genes in human papillary thyroid carcinomas. Oncogene7237242.

    • Search Google Scholar
    • Export Citation
  • HengstLReedSI1996Translational control of p27Kip1 accumulation during the cell cycle. Science27118611864.

  • Hilger-EversheimKMoserMSchorleHBuettnerR2000Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell-cycle control. Gene260112.

    • Search Google Scholar
    • Export Citation
  • HofstraRMLandsvaterRMCeccheriniIStulpRPStelwagenTLuoYPasiniBHoppenerJWvan AmstelHKRomeoG1994A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature367375376.

    • Search Google Scholar
    • Export Citation
  • HouPLiuDShanYHuSStudemanKCondourisSWangYTrinkAEl-NaggarAKTalliniG2007Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clinical Cancer Research1311611170.

    • Search Google Scholar
    • Export Citation
  • ItoEIwahashiYYanagisawaYSuzukiYSuganoSYuasaYMaruyamaK1999Two short sequences have positive effects on the human p27Kip1 gene transcription. Gene22893100.

    • Search Google Scholar
    • Export Citation
  • KawamataNMorosettiRMillerCWParkDSpirinKSNakamakiTTakeuchiSHattaYSimpsonJWilcyznskiS1995Molecular analysis of the cyclin-dependent kinase inhibitor gene p27/Kip1 in human malignancies. Cancer Research5522662269.

    • Search Google Scholar
    • Export Citation
  • KhooMLBeasleyNJEzzatSFreemanJLAsaSL2002Overexpression of cyclin D1 and underexpression of p27 predict lymph node metastases in papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism8718141818.

    • Search Google Scholar
    • Export Citation
  • KibelASSuarezBKBelaniJOhJWebsterRBrophy-EbbersMGuoCCatalonaWJPicusJGoodfellowPJ2003CDKN1A and CDKN1B polymorphisms and risk of advanced prostate carcinoma. Cancer Research6320332036.

    • Search Google Scholar
    • Export Citation
  • KondoTEzzatSAsaSL2006Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nature Reviews. Cancer6292306.

  • KossatzUMalekNP2007p27: tumor suppressor and oncogene…?Cell Research17832833.

  • LeePHShatkayH2008F-SNP: computationally predicted functional SNPs for disease association studies. Nucleic Acids Research36D820D824.

  • LiGSturgisEMWangLEChamberlainRMSpitzMREl-NaggarAKHongWKWeiQ2004Association between the V109G polymorphism of the p27 gene and the risk and progression of oral squamous cell carcinoma. Clinical Cancer Research1039964002.

    • Search Google Scholar
    • Export Citation
  • LindbergDAkerstromGWestinG2007Mutational analysis of p27 (CDKN1B) and p18 (CDKN2C) in sporadic pancreatic endocrine tumors argues against tumor-suppressor function. Neoplasia9533535.

    • Search Google Scholar
    • Export Citation
  • LiuZDongZHanBYangYLiuYZhangJT2005Regulation of expression by promoters versus internal ribosome entry site in the 5′-untranslated sequence of the human cyclin-dependent kinase inhibitor p27kip1. Nucleic Acids Research3337633771.

    • Search Google Scholar
    • Export Citation
  • LiuZHouPJiMGuanHStudemanKJensenKVaskoVEl-NaggarAKXingM2008Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. Journal of Clinical Endocrinology and Metabolism9331063116.

    • Search Google Scholar
    • Export Citation
  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods25402408.

    • Search Google Scholar
    • Export Citation
  • MillardSSVidalAMarkusMKoffA2000A U-rich element in the 5′ untranslated region is necessary for the translation of p27 mRNA. Molecular and Cellular Biology2059475959.

    • Search Google Scholar
    • Export Citation
  • MinYHCheongJWKimJYEomJILeeSTHahnJSKoYWLeeMH2004Cytoplasmic mislocalization of p27Kip1 protein is associated with constitutive phosphorylation of Akt or protein kinase B and poor prognosis in acute myelogenous leukemia. Cancer Research6452255231.

    • Search Google Scholar
    • Export Citation
  • MinamiSOhtani-FujitaNIgataETamakiTSakaiT1997Molecular cloning and characterization of the human p27Kip1 gene promoter. FEBS Letters41116.

    • Search Google Scholar
    • Export Citation
  • MottiMLCalifanoDTronconeGDe MarcoCMigliaccioIPalmieriEPezzulloLPalombiniLFuscoAVigliettoG2005Complex regulation of the cyclin-dependent kinase inhibitor p27kip1 in thyroid cancer cells by the PI3K/AKT pathway: regulation of p27kip1 expression and localization. American Journal of Pathology166737749.

    • Search Google Scholar
    • Export Citation
  • MulliganLMKwokJBHealeyCSElsdonMJEngCGardnerELoveDRMoleSEMooreJKPapiL1993Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature363458460.

    • Search Google Scholar
    • Export Citation
  • NaiduRHarYCTaibNA2007P27 V109G polymorphism is associated with lymph node metastases but not with increased risk of breast cancer. Journal of Experimental & Clinical Cancer Research26133140.

    • Search Google Scholar
    • Export Citation
  • NikiforovYE2002RET/PTC rearrangement in thyroid tumors. Endocrine Pathology13316.

  • PaganoMTamSWTheodorasAMBeer-RomeroPDel SalGChauVYewPRDraettaGFRolfeM1995Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science269682685.

    • Search Google Scholar
    • Export Citation
  • RandolphGWManiarD2000Medullary carcinoma of the thyroid. Cancer Control7253261.

  • Riesco-EizaguirreGSantistebanP2007Molecular biology of thyroid cancer initiation. Clinical and Translational Oncology9686693.

  • Ruiz-LlorenteSMontero-CondeCMilneRLMoyaCMCebrianALetonRCasconAMercadilloFLandaIBorregoS2007Association study of 69 genes in the ret pathway identifies low-penetrance loci in sporadic medullary thyroid carcinoma. Cancer Research6795619567.

    • Search Google Scholar
    • Export Citation
  • SaGGuoYStaceyDW2005The regulation of S phase initiation by p27Kip1 in NIH3T3 cells. Cell Cycle4618627.

  • Sambrook J Fritsch EF Maniatis T Irwin N & Maniatis T 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor NY: Cold Spring Harbor Laboratory Press.

  • SantoroMRosatiRGriecoMBerlingieriMTD'AmatoGLde FranciscisVFuscoA1990The ret proto-oncogene is consistently expressed in human pheochromocytomas and thyroid medullary carcinomas. Oncogene515951598.

    • Search Google Scholar
    • Export Citation
  • SlingerlandJPaganoM2000Regulation of the cdk inhibitor p27 and its deregulation in cancer. Journal of Cellular Physiology1831017.

  • SpurdleABDeansAJDuffyDGoldgarDEChenXBeesleyJEastonDFAntoniouACPeockSCookM2009No evidence that CDKN1B (p27) polymorphisms modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. Breast Cancer Research and Treatment115307313.

    • Search Google Scholar
    • Export Citation
  • TalliniGGarcia-RostanGHerreroAZeltermanDVialeGBosariSCarcangiuML1999Downregulation of p27KIP1 and Ki67/Mib1 labeling index support the classification of thyroid carcinoma into prognostically relevant categories. American Journal of Surgical Pathology23678685.

    • Search Google Scholar
    • Export Citation
  • TigliHBuyruNDalayN2005Molecular analysis of the p27/kip1 gene in breast cancer. Molecular Diagnosis91721.

  • VigliettoGMottiMLFuscoA2002Understanding p27(kip1) deregulation in cancer: down-regulation or mislocalization. Cell Cycle1394400.

  • VitaglianoDCarlomagnoFMottiMLVigliettoGNikiforovYENikiforovaMNHershmanJMRyanAJFuscoAMelilloRM2004Regulation of p27Kip1 protein levels contributes to mitogenic effects of the RET/PTC kinase in thyroid carcinoma cells. Cancer Research6438233829.

    • Search Google Scholar
    • Export Citation
  • WangWSpitzMRYangHLuCStewartDJWuX2007aGenetic variants in cell cycle control pathway confer susceptibility to lung cancer. Clinical Cancer Research1359745981.

    • Search Google Scholar
    • Export Citation
  • WangYHouPYuHWangWJiMZhaoSYanSSunXLiuDShiB2007bHigh prevalence and mutual exclusivity of genetic alterations in the phosphatidylinositol-3-kinase/akt pathway in thyroid tumors. Journal of Clinical Endocrinology and Metabolism9223872390.

    • Search Google Scholar
    • Export Citation
  • ZengYXSomasundaramKel-DeiryWS1997AP2 inhibits cancer cell growth and activates p21WAF1/CIP1 expression. Nature Genetics157882.

(I Landa and C Montero-Conde contributed equally to this work)

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 672 526 7
PDF Downloads 283 241 11

Altmetrics

Figures

  • View in gallery

    Transcriptional activity of constructs driven by the CDKN1B gene promoter containing the −79C or T allelic variant in HeLa cells. (A) The transcriptional activity of the pGL3-p27Kip1C and pGL3-p27Kip1T constructs in HeLa cells was evaluated in the presence or absence of serum. Luciferase activity was normalized to the internal Renilla control, after subtraction of pGl3D Basic Vector activity. Data represent the means±s.d. of three independent transfections. (B) Cell cycle-dependent transcriptional activity of the pGL3-p27Kip1C and pGL3-p27Kip1T constructs in HeLa cells. HeLa cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T constructs, and were subsequently starved in serum-free medium for 24 h. Cells were induced to re-enter the cell cycle by the addition of fresh medium supplemented with 10% FCS for 0, 12 and 24 h. At these time points, the cells were harvested, lysed and analyzed for luciferase activity.

  • View in gallery

    Transcriptional activity of constructs driven by the CDKN1B gene promoter containing the −79C or T allelic variant in rat thyroid cells. Rat thyroid PCCl3 cells were transfected with pGL3-p27Kip1C and pGL3-p27Kip1T constructs, and were subsequently placed in TSH-devoid (panel A) or complete medium (panel B). Cells were collected after 24 and 48 h, and luciferase activity was determined as described. Luciferase activity was normalized to the internal Renilla control after subtraction of pGl3D Basic Vector activity. Data represent the means±s.d. of three independent transfections.

  • View in gallery

    Differential expression of CDKN1B in human lymphocytes, depending on −79C>T (rs34330) genotype. (A) CDKN1B mRNA levels in lymphocytes from 97 control individuals, depending on the genotype of the promoter −79C>T polymorphism. Data points represent the average normalized mRNA amounts from three measurements for each sample, assessed by real-time quantitative RT-PCR. Horizontal bars represent the mean value for each genotype group. (B) CDKN1B mRNA levels of CC+CT against TT carrier individuals show a significant difference between these groups, which backs up the recessive model proposed.

  • View in gallery

    Immunoblot experiment assessing p27Kip1 protein levels in human lymphocytes, depending on −79C>T (rs34330) genotype. (A) Immunoblot evaluating the rs34330-dependent expression of p27Kip1 in whole-cell lysates from healthy volunteers' lymphocytes. Fifty micrograms of proteins were loaded in each lane. Equal loading was verified using α-tubulin as a reference. (B) p27Kip1 protein expression depending on −79C>T genotype. A trend towards lower p27Kip1 protein levels in −79TT carriers against non-risk genotypes (CC+CT) was observed. p27Kip1 protein levels are given in relative units (RU), and they resulted from the correction of p27Kip1 expression with α-tubulin levels in each case (p27Kip1/αTUB ratio).

References

  • BaldassarreGBellettiBBruniPBocciaATrapassoFPentimalliFBaroneMVChiappettaGVentoMTSpieziaS1999Overexpressed cyclin D3 contributes to retaining the growth inhibitor p27 in the cytoplasm of thyroid tumor cells. Journal of Clinical Investigation104865874.

    • Search Google Scholar
    • Export Citation
  • CebrianALesueurFMartinSLeylandJAhmedSLuccariniCSmithPLLubenRWhittakerJPharoahPD2005Polymorphisms in the initiators of RET (rearranged during transfection) signaling pathway and susceptibility to sporadic medullary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism9062686274.

    • Search Google Scholar
    • Export Citation
  • ChangBLZhengSLIsaacsSDWileyKETurnerALiGWalshPCMeyersDAIsaacsWBXuJ2004A polymorphism in the CDKN1B gene is associated with increased risk of hereditary prostate cancer. Cancer Research6419971999.

    • Search Google Scholar
    • Export Citation
  • ChiappettaGDe MarcoCQuintieroACalifanoDGherardiSMalangaDScrimaMMontero-CondeCCitoLMonacoM2007Overexpression of the S-phase kinase-associated protein 2 in thyroid cancer. Endocrine-Related Cancer14405420.

    • Search Google Scholar
    • Export Citation
  • ChuIMHengstLSlingerlandJM2008The Cdk inhibitor p27 in human cancer: prognostic potential and relevance to anticancer therapy. Nature Reviews. Cancer8253267.

    • Search Google Scholar
    • Export Citation
  • CondeLVaquerizasJMDopazoHArbizaLReumersJRousseauFSchymkowitzJDopazoJ2006PupaSuite: finding functional single nucleotide polymorphisms for large-scale genotyping purposes. Nucleic Acids Research34W621W625.

    • Search Google Scholar
    • Export Citation
  • DaviesHBignellGRCoxCStephensPEdkinsSCleggSTeagueJWoffendinHGarnettMJBottomleyW2002Mutations of the BRAF gene in human cancer. Nature417949954.

    • Search Google Scholar
    • Export Citation
  • DeLellis RA 2004 Pathology and Genetics of Tumours of Endocrine Organs. Lyon: IARC Press.

  • DriverKESongHLesueurFAhmedSBarbosa-MoraisNLTyrerJPPonderBAEastonDFPharoahPDDunningAM2008Association of single-nucleotide polymorphisms in the cell cycle genes with breast cancer in the British population. Carcinogenesis29333341.

    • Search Google Scholar
    • Export Citation
  • EricksonLAJinLWollanPCThompsonGBvan HeerdenJLloydRV1998Expression of p27kip1 and Ki-67 in benign and malignant thyroid tumors. Modern Pathology11169174.

    • Search Google Scholar
    • Export Citation
  • GaytherSASongHRamusSJKjaerSKWhittemoreASQuayeLTyrerJShadforthDHogdallEHogdallC2007Tagging single nucleotide polymorphisms in cell cycle control genes and susceptibility to invasive epithelial ovarian cancer. Cancer Research6730273035.

    • Search Google Scholar
    • Export Citation
  • GonzalezPDiez-JuanACotoEAlvarezVRegueroJRBatallaAAndresV2004A single-nucleotide polymorphism in the human p27kip1 gene (−838C>A) affects basal promoter activity and the risk of myocardial infarction. BMC Biology25.

    • Search Google Scholar
    • Export Citation
  • GrecoAPierottiMABongarzoneIPagliardiniSLanziCDella PortaG1992TRK-T1 is a novel oncogene formed by the fusion of TPR and TRK genes in human papillary thyroid carcinomas. Oncogene7237242.

    • Search Google Scholar
    • Export Citation
  • HengstLReedSI1996Translational control of p27Kip1 accumulation during the cell cycle. Science27118611864.

  • Hilger-EversheimKMoserMSchorleHBuettnerR2000Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell-cycle control. Gene260112.

    • Search Google Scholar
    • Export Citation
  • HofstraRMLandsvaterRMCeccheriniIStulpRPStelwagenTLuoYPasiniBHoppenerJWvan AmstelHKRomeoG1994A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature367375376.

    • Search Google Scholar
    • Export Citation
  • HouPLiuDShanYHuSStudemanKCondourisSWangYTrinkAEl-NaggarAKTalliniG2007Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clinical Cancer Research1311611170.

    • Search Google Scholar
    • Export Citation
  • ItoEIwahashiYYanagisawaYSuzukiYSuganoSYuasaYMaruyamaK1999Two short sequences have positive effects on the human p27Kip1 gene transcription. Gene22893100.

    • Search Google Scholar
    • Export Citation
  • KawamataNMorosettiRMillerCWParkDSpirinKSNakamakiTTakeuchiSHattaYSimpsonJWilcyznskiS1995Molecular analysis of the cyclin-dependent kinase inhibitor gene p27/Kip1 in human malignancies. Cancer Research5522662269.

    • Search Google Scholar
    • Export Citation
  • KhooMLBeasleyNJEzzatSFreemanJLAsaSL2002Overexpression of cyclin D1 and underexpression of p27 predict lymph node metastases in papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism8718141818.

    • Search Google Scholar
    • Export Citation
  • KibelASSuarezBKBelaniJOhJWebsterRBrophy-EbbersMGuoCCatalonaWJPicusJGoodfellowPJ2003CDKN1A and CDKN1B polymorphisms and risk of advanced prostate carcinoma. Cancer Research6320332036.

    • Search Google Scholar
    • Export Citation
  • KondoTEzzatSAsaSL2006Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nature Reviews. Cancer6292306.

  • KossatzUMalekNP2007p27: tumor suppressor and oncogene…?Cell Research17832833.

  • LeePHShatkayH2008F-SNP: computationally predicted functional SNPs for disease association studies. Nucleic Acids Research36D820D824.

  • LiGSturgisEMWangLEChamberlainRMSpitzMREl-NaggarAKHongWKWeiQ2004Association between the V109G polymorphism of the p27 gene and the risk and progression of oral squamous cell carcinoma. Clinical Cancer Research1039964002.

    • Search Google Scholar
    • Export Citation
  • LindbergDAkerstromGWestinG2007Mutational analysis of p27 (CDKN1B) and p18 (CDKN2C) in sporadic pancreatic endocrine tumors argues against tumor-suppressor function. Neoplasia9533535.

    • Search Google Scholar
    • Export Citation
  • LiuZDongZHanBYangYLiuYZhangJT2005Regulation of expression by promoters versus internal ribosome entry site in the 5′-untranslated sequence of the human cyclin-dependent kinase inhibitor p27kip1. Nucleic Acids Research3337633771.

    • Search Google Scholar
    • Export Citation
  • LiuZHouPJiMGuanHStudemanKJensenKVaskoVEl-NaggarAKXingM2008Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. Journal of Clinical Endocrinology and Metabolism9331063116.

    • Search Google Scholar
    • Export Citation
  • LivakKJSchmittgenTD2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods25402408.

    • Search Google Scholar
    • Export Citation
  • MillardSSVidalAMarkusMKoffA2000A U-rich element in the 5′ untranslated region is necessary for the translation of p27 mRNA. Molecular and Cellular Biology2059475959.

    • Search Google Scholar
    • Export Citation
  • MinYHCheongJWKimJYEomJILeeSTHahnJSKoYWLeeMH2004Cytoplasmic mislocalization of p27Kip1 protein is associated with constitutive phosphorylation of Akt or protein kinase B and poor prognosis in acute myelogenous leukemia. Cancer Research6452255231.

    • Search Google Scholar
    • Export Citation
  • MinamiSOhtani-FujitaNIgataETamakiTSakaiT1997Molecular cloning and characterization of the human p27Kip1 gene promoter. FEBS Letters41116.

    • Search Google Scholar
    • Export Citation
  • MottiMLCalifanoDTronconeGDe MarcoCMigliaccioIPalmieriEPezzulloLPalombiniLFuscoAVigliettoG2005Complex regulation of the cyclin-dependent kinase inhibitor p27kip1 in thyroid cancer cells by the PI3K/AKT pathway: regulation of p27kip1 expression and localization. American Journal of Pathology166737749.

    • Search Google Scholar
    • Export Citation
  • MulliganLMKwokJBHealeyCSElsdonMJEngCGardnerELoveDRMoleSEMooreJKPapiL1993Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature363458460.

    • Search Google Scholar
    • Export Citation
  • NaiduRHarYCTaibNA2007P27 V109G polymorphism is associated with lymph node metastases but not with increased risk of breast cancer. Journal of Experimental & Clinical Cancer Research26133140.

    • Search Google Scholar
    • Export Citation
  • NikiforovYE2002RET/PTC rearrangement in thyroid tumors. Endocrine Pathology13316.

  • PaganoMTamSWTheodorasAMBeer-RomeroPDel SalGChauVYewPRDraettaGFRolfeM1995Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science269682685.

    • Search Google Scholar
    • Export Citation
  • RandolphGWManiarD2000Medullary carcinoma of the thyroid. Cancer Control7253261.

  • Riesco-EizaguirreGSantistebanP2007Molecular biology of thyroid cancer initiation. Clinical and Translational Oncology9686693.

  • Ruiz-LlorenteSMontero-CondeCMilneRLMoyaCMCebrianALetonRCasconAMercadilloFLandaIBorregoS2007Association study of 69 genes in the ret pathway identifies low-penetrance loci in sporadic medullary thyroid carcinoma. Cancer Research6795619567.

    • Search Google Scholar
    • Export Citation
  • SaGGuoYStaceyDW2005The regulation of S phase initiation by p27Kip1 in NIH3T3 cells. Cell Cycle4618627.

  • Sambrook J Fritsch EF Maniatis T Irwin N & Maniatis T 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor NY: Cold Spring Harbor Laboratory Press.

  • SantoroMRosatiRGriecoMBerlingieriMTD'AmatoGLde FranciscisVFuscoA1990The ret proto-oncogene is consistently expressed in human pheochromocytomas and thyroid medullary carcinomas. Oncogene515951598.

    • Search Google Scholar
    • Export Citation
  • SlingerlandJPaganoM2000Regulation of the cdk inhibitor p27 and its deregulation in cancer. Journal of Cellular Physiology1831017.

  • SpurdleABDeansAJDuffyDGoldgarDEChenXBeesleyJEastonDFAntoniouACPeockSCookM2009No evidence that CDKN1B (p27) polymorphisms modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. Breast Cancer Research and Treatment115307313.

    • Search Google Scholar
    • Export Citation
  • TalliniGGarcia-RostanGHerreroAZeltermanDVialeGBosariSCarcangiuML1999Downregulation of p27KIP1 and Ki67/Mib1 labeling index support the classification of thyroid carcinoma into prognostically relevant categories. American Journal of Surgical Pathology23678685.

    • Search Google Scholar
    • Export Citation
  • TigliHBuyruNDalayN2005Molecular analysis of the p27/kip1 gene in breast cancer. Molecular Diagnosis91721.

  • VigliettoGMottiMLFuscoA2002Understanding p27(kip1) deregulation in cancer: down-regulation or mislocalization. Cell Cycle1394400.

  • VitaglianoDCarlomagnoFMottiMLVigliettoGNikiforovYENikiforovaMNHershmanJMRyanAJFuscoAMelilloRM2004Regulation of p27Kip1 protein levels contributes to mitogenic effects of the RET/PTC kinase in thyroid carcinoma cells. Cancer Research6438233829.

    • Search Google Scholar
    • Export Citation
  • WangWSpitzMRYangHLuCStewartDJWuX2007aGenetic variants in cell cycle control pathway confer susceptibility to lung cancer. Clinical Cancer Research1359745981.

    • Search Google Scholar
    • Export Citation
  • WangYHouPYuHWangWJiMZhaoSYanSSunXLiuDShiB2007bHigh prevalence and mutual exclusivity of genetic alterations in the phosphatidylinositol-3-kinase/akt pathway in thyroid tumors. Journal of Clinical Endocrinology and Metabolism9223872390.

    • Search Google Scholar
    • Export Citation
  • ZengYXSomasundaramKel-DeiryWS1997AP2 inhibits cancer cell growth and activates p21WAF1/CIP1 expression. Nature Genetics157882.

Cited By

PubMed

Google Scholar