Abstract
The involvement of the coxsackie and adenovirus receptor (CAR), an adhesion molecule known to be the main determinant of adenovirus transduction of the cells, in cancer is currently under investigation. Recent reports suggest that CAR levels are elevated in breast cancer, and this may have an impact on its use as means of delivery for gene therapy. In this study, we show that estradiol (E2) treatment of the estrogen receptor (ER)-positive breast cancer cell MCF-7 increases CAR levels and, in turn, enhances adenoviral transduction. Employing the transfection of CAR promoters in breast cancer cells, we show that this regulation of CAR expression occurs at the transcriptional level. In addition, and by chromatin immunoprecipitation, we have identified a crucial region of CAR promoter that controls E2 responsiveness of CAR gene through the recruitment of ER. Moreover, utilizing CAR antibodies or CAR silencing by RNA interference repressed the estrogen-dependent growth of breast cancer cells, whereas the stable expression of CAR in MCF-7 or MDA-MB-231 cells led to an increased proliferation. Altogether, our data suggest that CAR is a novel estrogen-responsive gene, which is involved in the E2-dependent proliferation of breast cancer cells.
Introduction
The coxsackie and adenovirus receptor (CAR) is a transmembrane protein that was initially characterized by its ability to allow adenovirus attachment through cells via the interaction with the adenovirus fiber-knob protein (Bergelson et al. 1997, Lucas et al. 2003, Glasgow et al. 2006). Splice variants of CAR have also been identified, which could generate soluble forms of the CAR protein that lack a transmembrane domain (exon 6) (Thoelen et al. 2001). In normal cells, CAR is associated with tight junctions (TJs) protein complexes (Cohen et al. 2001). CAR has recently been suspected to be involved in cancer development, but its role remains controversial. Several studies have shown that CAR expression was reduced in cancer tissues compared with normal tissues in the case of bladder, renal, and prostate cancers (Li et al. 1999, Okegawa et al. 2000, Okegawa et al. 2001, Haviv et al. 2002, Sachs et al. 2002, Matsumoto et al. 2005), whereas in the breast, CAR expression is increased in tumors (Martin et al. 2005). The loss of CAR expression is also associated with increased metastasis of bladder tumors (Matsumoto et al. 2005).
So far, very little is known about CAR expression in breast cancer biopsy, and the situation appears to be significantly different from other cancers. A study showed that CAR levels are elevated in breast cancer and increase during progression and metastasis (Martin et al. 2005). In addition, CAR expression is correlated to estrogen receptor (ER) expression in breast cancer cells (Auer et al. 2009). Estrogens are potent mitogens in cancerous breast tissue (Henderson et al. 1988, Lazennec et al. 1999, Katzenellenbogen et al. 2000). Studies in breast cancer tissue, both in vivo and in vitro, have shown that estrogen dramatically escalates proliferative and metastatic activity in these tumor cells. The growth of ∼70% of all human breast cancers is dependent upon the presence of an estradiol (E2)–ER complex (Santen et al. 1990). The genomic action of estrogen is mediated by two ERs, namely ERα and ERβ (Katzenellenbogen et al. 2000). ERα is mainly involved in the mitogenic action of estrogens, whereas ERβ is rather anti-proliferative both in breast, prostate, and ovarian cancer (Lazennec et al. 2001, Bardin et al. 2004, Cheng et al. 2004, Lazennec 2006).
The aim of this study was to analyze the link between CAR and estrogen signaling in breast cancer and to determine the possible role of CAR in breast cancer and the mechanisms of regulation of CAR by estrogens. We report that the treatment of ER-positive breast cancer cells leads to an increased transduction by adenovirus, which is concomitant with an induction of CAR mRNA and protein levels. The analysis of the CAR promoter revealed that CAR regulation by estrogens occurs at the transcriptional level, through an estrogen-responsive element (ERE). Very interestingly, the blockage of CAR action was sufficient to reduce the estrogen-dependent proliferation of breast cancer cells, whereas the ectopic expression of CAR could increase the proliferation of breast cancer cells.
Materials and methods
Cell culture
MCF-7 and MDA-MB-231 cells were maintained in DMEM-F12 and supplemented with 10% FCS and gentamycin as described previously (Lazennec et al. 1996). For infection assays, cells were seeded on 6-well plates. Before any experiment, cells were weaned off steroids by being cultured in phenol red-free DMEM/F12 that had been supplemented with 10% charcoal dextran-treated FCS (CDFCS) for 5 days.
RNA extraction and reverse transcriptase PCR
Total RNA was isolated with TRIzol reagent (Invitrogen) as described by the manufacturer. Reverse transcription was performed using random primers and Superscript II enzyme (Invitrogen). Real-time PCR quantification was then performed using a SYBR Green approach (Light Cycler; Roche), as described previously (Lucas et al. 2003). For each sample, CAR or pS2/TFF1 mRNA levels were normalized with RS9 or Rplp0 mRNA levels (reference genes). The sequences of the oligonucleotides used were CAR (transmembrane CAR, exons 6/7, (Thoelen et al. 2001)) (left 5′-GCAGGAGCCATTATAGGAACTTTG-3′; right 5′-GGACCCCAGGGATGAATGAT-3′), pS2/TFF1 (left 5′-ACCATGGAGAACAAGGTGA-3′; right 5′-CCGAGCTCTGGGACTAATCA-3′), RS9 (left 5′-CAGGCGCAGACGGTGGAAGC-3′; right 5′-CGCGAGCGTGGTGGATGGAC-3′), Rplp0 (left 5′-AAYGTGGGCTCCAAGCAGATG-3′; right 5′-GAGATGTTCAGCATGTTCAGCAG-3′).
Recombinant adenovirus construction, propagation, and infection
The adenoviruses encoding the β-galactosidase (Ad-GAL) or ERα (Ad-ERα) used in this study have been previously described (Lazennec et al. 1999, 2001, Lucas et al. 2003). Briefly, the complete coding sequences of β-galactosidase, or human ERα cDNAs, were subcloned in a pACsk12CMV5 shuttle vector. To obtain recombinant viruses, permissive HEK-293 cells (human embryonic kidney cells) were cotransfected with pACsk12CMV5, or the recombinant pACsk12CMV5 plasmid, and with pJM17 that contains the remainder of the adenoviral genome. In vivo recombination of the plasmids generates infectious viral particles, non-recombinant adenovirus Ad5, or recombinant adenovirus Ad-GAL and Ad-ERα. MCF-7 or MDA-MB-231 cells were infected overnight at different multiplicities of infection (MOI) in DMEM/F12 10% CDFCS. The next day, the medium was changed and the cells were let to express β-GAL for 48 h before collecting the medium.
β-Galactosidase histochemical staining assay
After 48 h of expression, infected cells were washed twice with PBS and then fixed for 5 min at 4 °C in a fixing solution (2% formaldehyde, 0.2% glutaraldehyde, and 1×PBS). Cells were washed once and incubated for 4 h at 37 °C in histochemical staining solution (5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 1×PBS, and 1 mg/ml X-GAL; Lucas et al. 2003). Cells were then washed twice with PBS and observed.
Western blot experiments
Cells were harvested in Tris–glycerol buffer (Tris–HCl 50 mM, EDTA 1.5 mM, and 10% glycerol) supplemented with protease inhibitor cocktail (Roche) and were then sonicated. Protein extracts (30 μg) were subjected to SDS-PAGE protein samples under non-reducing conditions. Samples were heated normally at 95 °C for 5 min in a sample loading buffer that lacked mercaptoethanol. Western blot analyses were done using CAR antibody (sc-56892, Santa Cruz, CA, USA) and β-actin (Sigma–Aldrich). Immunoreactivity was detected with Amersham ECL system. Actin was used as a loading control.
Constructs and transient transfection
A CAR promoter corresponding to sequences -1213/-127 (pGL3-1087) has been previously described (Pong et al. 2003). Deleted constructs of the CAR promoter (pGL3-522: -648/-127; pGL3-428: -554/-127) were cloned into pGL3 basic vectors (Promega). Site-directed mutagenesis of CAR ERE was performed with CAR-EREm primers (TCGCATCCCGTGgGCATGtcGTCAGAGAACCTGCC) to generate pGL3-EREm construct. The ERE-TK-LUC construct consists of two ERE in tandem upstream of TK promoters (Duong et al. 2006). We plated 3.105 of steroid-weaned cells in 12-well plates in phenol red-free DMEM-F12 and supplemented with 10% CDFCS 24 h before transfection. Transfections were performed using lipofectamine according to the manufacturer's recommendations, using 2 μg of the CAR promoter pGL3-1087, luciferase reporter, or CAR promoted deleted constructs along 0.5 μg of the internal reference reporter plasmid (CMV-Gal) per well. After 6 h incubation, the medium was removed and the cells were placed into a fresh medium supplemented with a control vehicle (ethanol) or E2. After 24 h, cells were harvested and assayed for luciferase activity using a Centro LB960 Berthold luminometer. β-galactosidase was determined as described previously (Duong et al. 2006).
siRNA experiments
CAR protein was knocked down by transfection of MCF-7 cells with specific siRNA (GGAAGUUCAUCACGAUAUAUC, Eurofins) according to manufacturer's protocol. Non-targeting control siRNA (siGLO red) was purchased from Dharmacon. Protein levels were determined by western blot.
CAR stable transfectants
The stably transfected MCF-7-CAR and MDA-MB-231-CAR cell lines were obtained after transfection with the plasmid pcDNA3-hCAR (a kind gift of Dr S Hemmi), encoding the human CAR cDNA under the control of the CMV promoter. Transfected cells were then selected by G418 at a concentration of 2 mg/ml. After 2 weeks of selection, a pool of resistant cells was collected and used for further experiments.
Chromatin immunoprecipitations
These assays were conducted with some modifications from Métivier et al. (2003), using 1.107 MCF-7 or MDA-MB-231 cells that were placed in DMEM/0.5% CDFCS for 3 days. Afterward, some were treated with 10 nM E2 four different times. Following cross-linking (1.5% formaldehyde for 10 min at room temperature), cells were collected in a 1 ml collection buffer (100 mM Tris–HCl (pH 9.4) and 100 mM dithiothreitol), and incubated on ice for 10 min and subsequently at 30 °C for 10 min. Cells were then lysed in a 300 μl lysis buffer (10 mM EDTA, 50 mM Tris–HCl (pH 8.0), 1% SDS, and 0.5% Empigen BB (Sigma)). Extracts were then sonicated for 14 min using a BioRuptor apparatus (Diagenode), with 30 s on/off cycles. Following 10 min centrifugation at 10 000 g, 50 μl of the supernatants were used as inputs, and the remainder diluted threefold in IP buffer (2 mM EDTA, 100 mM NaCl, 20 mM Tris–HCl (pH 8.1), and 0.5%Triton X-100). Extracts were pre-cleared for 3 h at 4 °C with 150 μl of a 50% protein A-Sepharose bead (Amersham Pharmacia Biosciences) slurry containing 10 μg yeast tRNA (Sigma). Following centrifugation at 800 g for 1 min, one-third of the extracts were taken for immunoprecipitation using 1μg of antibodies directed against ER (HC20, Santa Cruz) or the epitope HA (HA-probe Y11, Santa Cruz) and diluted three times in a IP buffer. Complexes were recovered by a 3 h incubation at 4 °C with 50 μl of protein A-Sepharose slurry containing 10 μg yeast tRNA. Precipitates were then serially washed, using 300 μl of washing buffers (WB) I (2 mM EDTA, 20 mM Tris–HCl (pH 8.1), 0.1% SDS, 1% Triton X-100, and 150 mM NaCl), WB II (2 mM EDTA, 20 mM Tris–HCl (pH 8.1), 0.1% SDS, 1% Triton X-100, and 500 mM NaCl), WB III (1 mM EDTA, 10 mM Tris–HCl (pH 8.1), 1% NP-40, 1% deoxycholate, and 0.25 M LiCl), and then twice with 1 mM EDTA and 10 mM Tris–HCl (pH 8.1). Precipitated complexes were removed from the beads through three sequential incubations of 10 min with 50 μl of 1% SDS and 0.1 M NaHCO3. Cross-linking was then reversed by an overnight incubation at 65 °C. DNA was purified with Qiaquick columns (Qiagen). Subsequent quantitative PCRs analysis used 1 μl of input material and 5 μl of chromatin immunoprecipitation (ChIP) samples and were performed on a Bio-Rad MyiQ apparatus using Bio-Rad iQ SYBR Green supermix. The sequences of the oligonucleotides used, designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), are: CAR (left 5′-cctctcgcgctttttatgtc-3′; right 5′-tctctgacctcatgctcacg-3′), pS2/TFF1 (left 5′-TCATCTTGGCTGAGGGATCT-3′; right 5′-TTCCGGCCATCTCTCACTAT-3′), Rplp0 (left 5′-ATCTAACTAGCACACGAACCTT-3′; right 5′-CTGTATTCGTTCAGCTTTGTCT-3′). The PCR efficiency was calculated for each oligonucleotide set, using serial dilutions of inputs. Once normalized to inputs following the ΔCt method, the results were normalized again to the ChIP performed using the control anti-HA antibody.
Proliferation assay
MCF-7 cells that had been stably transfected with a CMV-LUC reporter were grown in 24-well plates in the presence of 10-9 M E2 for 4-days, and in the presence of 20 μl of whole mouse serum or E1-1 anti-CAR hybridoma supernatant (Hemmi et al. 1998). Cells were then collected and luciferase activity was measured. Concerning wild-type MCF-7, MCF-7-CAR, MDA-MB-231, and MDA-MB-231-CAR, their proliferation was quantified by counting the cells on a cell counter.
Results
E2 increases the transduction of ER-positive breast cancer cells by adenovirus
The role and the regulation of CAR expression in breast cancer cells remain elusive. We hypothesized that estrogens, which regulate the growth of ER-positive breast cancer cells, could modify their sensitivity to adenoviral infection, through a regulation of CAR levels. To analyze whether estrogens could modify the adenoviral transduction, we pre-treated ER-positive breast cancer cells MCF-7 with E2 for 24 h before infecting them with an adenovirus encoding β-galactosidase (Ad-GAL) at increasing MOIs. We observed that adenoviral transduction was strongly enhanced in E2-treated cells compared with control cells (Fig. 1A), which suggests that E2 modifies the expression of a factor involved in adenoviral transduction. Microscopic observation confirmed that the increased staining of the plates was the result of a higher number of infected cells (Fig. 1B). On the other hand, ER-negative MDA-MB-231 cells were similarly infected by the virus in the absence or the presence of E2, demonstrating that ER was required for E2 regulation of adenoviral transduction (Fig. 1C).
Estradiol increases adenovirus transduction. (A) ER-positive breast cancer cells, MCF-7 cells, were treated for 24 h with ethanol vehicle (C) or estradiol (E2; 10−9 M) before infection with Ad-GAL virus at increasing multiplicity of infection (MOI=0, 1, 5, 25, 75, 375). The infected cells were then grown for 48 h with ethanol vehicle or estradiol (10−9 M) and stained for β-gal activity as described in ‘Materials and methods’. (B) MCF-7 cells infected with adenovirus at MOI=1 and treated with or without E2. Quantification of β-gal-positive cells after adenovirus infection. β-gal-positive cells were counted from two non-overlapping fields. Results represent the mean±s.d. of three independent experiments and are expressed as the percentage of control cells. (C) ERα-negative MDA-MB-231 cells were infected with adenovirus under the same conditions as in B. Results represent the quantification of β-gal-positive cells after adenovirus infection (n=3).
Citation: Endocrine-Related Cancer 18, 3; 10.1530/ERC-10-0230
CAR levels are up-regulated by E2
As CAR is the main determinant of adenovirus infection, we hypothesized that its expression could be regulated by estrogens, which in turn explains the effects of E2 on adenoviral transduction. To determine whether E2 was modulating CAR RNA levels, we treated MCF-7 cells at different times with E2. We measured the levels of transmembrane CAR isoform (see Materials and methods) by real-time PCR. We observed that CAR RNA expression was induced at 8 h of E2 treatment and returned to basal levels after 24 h (Fig. 2A). To ensure that the regulation of CAR RNA levels by E2 were mediated by the ER, MCF-7 cells were cotreated for 8 h with E2 and the pure anti-estrogen ICI182 780, which could strongly reduce CAR RNA induction by E2 (Fig. 2A). CAR levels were also induced in another ER-positive breast cancer cell line, CAMA-1, suggesting that this was not specific of MCF-7 cells (data not shown). In addition, CAR protein levels were also increased upon E2 treatment, as shown by western blot, but this induction by E2 returned to basal levels only at 48 h (Fig. 2B). We performed the same analysis in the ER-negative breast cancer cell line MDA-MB-231 (Fig. 2C) and observed that CAR protein levels were not significantly affected by E2 in these cells. This further demonstrates that ER is necessary for CAR induction by E2.
CAR expression is induced by E2. (A) MCF-7 cells were treated with control vehicle ethanol, E2 (10−9 M) for 8 or 24 h or with E2+ICI182 780 (ICI; 10−6 M) for 8 h. CAR RNA levels were determined by real-time PCR. Results represent the mean of three independent experiments and are expressed as the percentage of control cells. (B) The levels of CAR protein were measured by western blot with CAR antibody using extracts from MCF-7 cells treated with E2 (10−9 M) for 4, 8, or 24 h. β-actin levels were detected to demonstrate equal loading. (C) Same experiment as in B, but in MDA-MB-231 cells.
Citation: Endocrine-Related Cancer 18, 3; 10.1530/ERC-10-0230
CAR gene promoter is regulated by estrogens
Next, we investigated the possible regulation of CAR gene promoters by estrogens in MCF-7 cells. The transfection of CAR promoter reporter gene construct showed that it was induced 1.8-fold by E2 in MCF-7 cells (Fig. 3A). On the contrary, in the ER-negative breast cancer cell MDA-MB-231, the CAR promoter was not induced by E2 (Fig. 3B), demonstrating that CAR is required for the regulation of CAR promoter by estrogens. We performed a computer analysis of the CAR promoter, and we identified four half-ERE (ER binding site) and one putative ERE (-571/-557) based on the consensus ERE sequence (Gruber et al. 2004, O'Lone et al. 2004; Fig. 4A). We used first deletion constructs of the CAR promoter (Fig. 4B). pGL3-522 (-648/-127) construct retained E2 inducibility, but the further deletion of 94 bp (pGL3-428, -554/-127) by removing the putative ERE was sufficient to lose the responsiveness to E2 (Fig. 4B). Using a point mutation construct of the ERE, we observed a strong reduction of CAR promoter induction by E2 as well (Fig. 4B), reinforcing the central role of this ERE sequence in modulating CAR promoter activity. To validate the functionality of CAR ERE, we performed ChIPs experiments. These experiments were performed in MCF-7 cells, which exhibit an estrogenic stimulation of CAR and pS2/TFF1 genes (Fig. 4C). ChIPs showed an early recruitment of ERα to CAR ERE sequence in 30 min (Fig. 4D). The kinetic of recruitment of ERα to CAR promoter was more rapid than the one observed for the pS2/TFF1 promoter, which is also in agreement with the distinct kinetics of estrogen regulation of CAR and pS2/TFF1 mRNA (Fig. 4C, D). Finally, the ability of ERα to bind to CAR ERE sequence was also confirmed by gel shift assays (data not shown).
CAR promoter activity is enhanced by E2 in ER-positive breast cancer cells. (A) MCF-7 cells were transfected with pGL3, pGL3-1087, or ERE2-TK constructs, along with CMV-GAL as a control for transfection efficiency. Cells were grown in the presence or the absence of E2 (10−9 M). Results show relative luciferase activities (% of values of pGL3 vector without E2) after normalization with β-gal activity (three independent experiments). **P<0.001 using Student's t-test. (B) MDA-MB-231 cells were transfected with a pGL3-1087 construct, along with CMV-GAL, as a control for transfection efficiency. Cells were grown in the presence or the absence of E2 (10−9 M). Results show relative luciferase activities after normalization with β-gal activity (three independent experiments).
Citation: Endocrine-Related Cancer 18, 3; 10.1530/ERC-10-0230
Identification of an ERE in CAR promoter. (A) Sequence of CAR promoters with the presence of half-ERE sites and an ERE sequence (TGAGCatgAGGTCA). The sequences of CAR-EREWT and CAR-EREm (mutant) oligonucleotides used in gel shift experiments are indicated at the bottom of the figure. (B) MCF-7 cells were transfected with pGL3-1087, pGL3-522, pGL3-428, or pGL3-EREm constructs along with CMV-GAL as a control for transfection efficiency. Cells were grown in the presence or the absence of E2 (10−9 M). Results show relative luciferase activities (% of values of pGL3 basic vector without E2) after normalization with β-gal activity (three independent experiments). (C) MCF-7 cells were treated with control vehicle ethanol (C) or E2 (10−9 M) for different times. CAR (left graph) and pS2/TFF1 (right) mRNA levels were determined by real-time PCR. Results represent the mean of three independent experiments and are expressed as % of controls (C). (D) Chromatin was prepared from MCF-7 cells treated as in RT-PCR experiments, or from ER-negative MDA-MB-231 cells (MDA), which were used as a control for specific immunoprecipitation. ChIP assays were then performed using antibodies directed against ER or the epitope HA as an additional control. Specific enrichment of CAR, pS2/TFF1, and control Rplp0 promoter regions in anti-ER Chip-ped material was then evaluated by quantitative PCR, with values normalized to those obtained in samples immunoprecipitated using the control antibody (C). The regions amplified are illustrated within the schemes above each graph. Results represent the mean of three independent experiments.
Citation: Endocrine-Related Cancer 18, 3; 10.1530/ERC-10-0230
CAR is involved in breast cancer proliferation
As CAR expression is regulated by estrogens, we next hypothesized that CAR could be involved in the proliferation of ER-positive cells. MCF-7 cells were cultured in the presence of estrogen and treated either with control serum or anti-CAR antibody. Results showed that CAR antibody reduced half the proliferation of cancer cells in the presence of E2 (Fig. 5A), which suggests that upregulation of CAR by estrogen is an important step in the control of estrogen-dependent growth of ER-positive breast cancer cells. In the absence of E2, the CAR antibody did not significantly alter cell proliferation. We used a second approach based on siRNA to demonstrate the role of CAR in MCF-7 cell proliferation. Transfection of a siRNA against CAR inhibited the induction of proliferation of MCF-7 cells by E2 (Fig. 5B). To further confirm the potential role of CAR in breast cancer cell proliferation, we generated a pool of stable transfectant MCF-7 cells for CAR (Fig. 5C). When comparing the MCF-7-CAR cells to wild-type MCF-7 cells, we observed that MCF-7-CAR cells displayed a higher proliferation rate compared with wild-type MCF-7 cells, in the absence and the presence of E2 (Fig. 5D). Of particular note, MCF-7-CAR cells grown in the absence of E2 had a similar proliferation as wild-type MCF-7 in the presence of E2. This data confirms that CAR can enhance the proliferation of breast cancer cells. To demonstrate that CAR effects were not specific to a single cell line, we also generated a CAR stable transfectant in MDA-MB-231 cells (Fig. 5E). MDA-MB-231-CAR also displayed an enhanced proliferation compared with wild-type cells (Fig. 5F), reinforcing the fact that CAR stimulates breast cancer cell proliferation.
CAR enhances breast cancer cell proliferation. (A) MCF-7 cells were grown in DMEM-F12 supplemented with CD-FCS without (w/o E2), or with 10−9 M E2 (+E2), and incubated with pre-immune serum (mock), or CAR antibody (CAR Ab). Cells stably expressing luciferase reporters were lysed at days 2, 4, and 6 and subjected to luciferase activity. Results are expressed as fold of control cells grown in the absence of estradiol at day 0, and in the absence of mouse pre-immune serum and data represent the mean±s.d. from triplicates. (B) MCF-7 cells were transfected with non-targeting siRNA (siC), or with CAR siRNA (siCAR), and treated with 10−9 M E2 (+E2). Left panel: measure of CAR and protein levels in transfected cells by western blot at day 3. β-Actin levels were detected to demonstrate equal loading. Right panel: proliferation was measured at day 3 after transfection, and results are expressed as fold of control cells grown in the absence of estradiol at day 0. Data represent the mean±s.d. from triplicates. (C) Characterization of the pool of MCF-7-CAR stable transfectants by western blot. β-actin levels were detected to demonstrate equal loading. (D) Wild-type MCF-7 cells or MCF-7-CAR cells (CAR) were grown in DMEM-F12 supplemented with CD-FCS without or with 10−9 M E2 (+E2). Proliferation rate is expressed as fold of control cells grown in the absence of estradiol at day 0. The data represents the mean±s.d. from triplicates. (E) Characterization of the pool of MDA-MB-231-CAR stable transfectants by western blot. β-actin levels were detected to demonstrate equal loading. (F) Wild-type MDA-MB-231 cells or MDA-MB-231-CAR cells (CAR) were grown in DMEM-F12 supplemented with FCS. Proliferation is expressed as fold of control cells grown at day 0. Data represent the mean±s.d. from triplicates.
Citation: Endocrine-Related Cancer 18, 3; 10.1530/ERC-10-0230
Discussion
Recent studies have highlighted the possible role of CAR in carcinogenesis. However, it remains unclear whether CAR levels are modified in breast cancer cells, and what the signals controlling its expression in such cells are. In this report, we have addressed the role of CAR in breast cancer and its regulation by estrogens.
Although most of the studies have shown that CAR levels were decreased in the aggressive forms of several cancers, including glioma and bladder cancer (Okegawa et al. 2001, Kim et al. 2003), the breast cancer situation seems to be different. Indeed, it was shown that CAR levels were elevated in breast cancer tissues (Martin et al. 2005). Bruning et al. 2005 also observed in a murine model of breast cancer that CAR expression was upregulated in carcinoma compared with pre-neoplastic lesion. To date, the role of CAR in breast cancer and the factors regulating CAR expression are poorly understood. Previous studies have shown that treatment of cancer cells with histone deacetylase inhibitors upregulates CAR expression (Kitazono et al. 2001, Hemminki et al. 2003, Pong et al. 2003, Okegawa et al. 2007). Other signals such as the MAPK pathway, the action of glucocorticoids, tumour necrosis factor α, and transforming growth factor-β also modulate CAR expression (Anders et al. 2003, Bruning & Runnebaum 2003). Pong et al. 2006 have also reported an induction of CAR expression by the phytoestrogen genistein in bladder cells, but it remains unclear whether this occurs through ER.
CAR levels are one of the primary determinants of adenoviral transduction. In this study, we show that E2 increases ER-positive breast cancer cell transduction by type 5 adenoviruses. We also observed that CAR levels were increased by E2 in ER-positive breast cancer cells, which is in agreement with a previous study, using the ER-positive breast cancer cell line T47-D (Auer et al. 2009). This regulation was dependent on ERs, as E2 had no effect on CAR levels and promoter activity in ERα-negative MDA-MB-231 breast cancer cells. CAR expression was induced both at the RNA and protein levels by E2. However, CAR RNA induction by E2 was transient, whereas CAR protein induction could last for more than 24 h. This suggests that CAR RNA and protein kinetics of regulation and stability are different. It is possible that CAR protein stability is affected indirectly by E2 through the synthesis of factors controlling its turnover, which could explain the delayed induction of CAR protein expression.
Based on the rapid increase of CAR RNA levels, we thus speculated that the regulation of CAR gene by estrogens could be the result of a direct transcriptional regulation. Transfection experiments showed that CAR promoter was directly regulated by estrogens, through an ERE located in the first 600 bp of CAR gene promoter as shown by transfection, ChIPs, and gel shift experiments. The ERE sequence found in CAR promoter was a palindrome non-consensus sequence with a 3 bp spacing, which is the most common situation found in genes regulated by estrogen (Gruber et al. 2004, O'Lone et al. 2004).
Estrogens are known to be potent mitogen signals for ER-positive breast cancer cells (Prall et al. 1998), which could also potentially involve adhesion molecules such as CAR. It was previously shown that estrogen can modulate the expression of other adhesion molecule such as N-cadherin, which is upregulated by E2 (MacCalman et al. 1995), or E-cadherin that is downregulated by E2 (Oesterreich et al. 2003). These molecules might directly or indirectly modulate cell proliferation, notably through cell architecture reorganization.
The possible role of CAR in cancer cell proliferation remains controversial. Most studies have shown in bladder, cervical, ovary cancers, and glioma that CAR was repressing cell proliferation (Okegawa et al. 2001, Kim et al. 2003, Bruning & Runnebaum 2004, Huang et al. 2005, Wang et al. 2005, Zhang et al. 2007), whereas others have shown mitogenic properties for CAR in lung cancer (Qin et al. 2004, Veena et al. 2009). The situation in breast cancer might be unique compared with other cancers. Indeed, it was shown that CAR antagonizes the action of apoptosis inducing agents and in turn increases breast cancer cell survival (Bruning et al. 2005). In a similar manner, as for lung cancer in which CAR silencing reduces tumor growth (Veena et al. 2009), we show that CAR antibodies or CAR siRNA inhibit the estrogen-dependent growth of MCF-7 cells. We did not observe any sign of mortality when cells were treated with the CAR antibody, which suggests that CAR affects mainly cell proliferation than survival. In addition, we report that stable expression of CAR in MCF-7 cells enhances both the basal and the estrogen-induced proliferation of these cells. This observation suggests that CAR could confer a hormone-independent growth to ER-positive breast cancer cells. Moreover, CAR can also increase the proliferation of ERα-negative MDA-MB-231 cells, suggesting that CAR could affect different types of breast cancer cells in a similar manner. The mechanisms underlying CAR effects on proliferation in breast cancer cells remain to be investigated. We believe that cell-specific factors present in breast cancer cells, and not in cancer cells of other origins, might explain why CAR stimulates the proliferation in breast cancer cells, whereas it represses the proliferation in other cancers.
The effects of CAR on proliferation, which is mainly described as an adhesion molecule, might not be direct in breast cancer cells. CAR is a major component of TJs, as are other molecules such as occludin, claudin, tricellulin, and junction adhesion molecules (JAMs; Coyne & Bergelson 2005). In polarized epithelial cells, CAR is detected at the apical pole of the lateral membrane, where it colocalizes with the TJ protein zonula occludens-1 (ZO-1; Cohen et al. 2001). Recent reports suggest that TJs could regulate cell proliferation (Tsukita et al. 2008). TJs contain aqueous pores or channels that regulate paracellular permeability and serve to divide the apical and basolateral membrane compartments. As a component of TJs, CAR could affect ionic or pH conditions around epithelial cells and in turn modulates cell proliferation (Tsukita et al. 2008). Another hypothesis is that altering the features of cell adhesion by CAR could modify cell signaling and interaction with other cofactors that directly control the proliferation or cell architecture. Increasing evidence suggest that TJs regulate gene expression (Balda & Matter 2009). It has been shown that the cytoplasmic plaque associated with TJs is formed by multiple adaptors, scaffold proteins, and signaling components such as GTP-binding proteins, protein kinases, and phosphatases. These proteins can in turn modulate the expression or the activity of downstream signaling molecules such as cyclins, Jun/fos, or c-myc, which are known to regulate cell cycle (Balda & Matter 2009). In particular, it might be possible that CAR could indirectly affect phosphorylation levels of ER, which is a known mechanism for hormone-independent proliferation of ER-positive breast cancer cells. Cell context might explain the opposite effects of CAR in breast cancer cells compared with other types of cancers. We cannot exclude the possibility that the presence of ER in breast cancer cells could enable a different network of factors susceptible to act in coordination with CAR to elicit cell proliferation.
These results, together with the up-regulation of CAR by E2, suggest that CAR could be one of the early events leading to the induced proliferation of breast cancer cells. Our data could open the road for novel strategies to target ER-positive breast cancers.
Declaration of interest
There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
D V and L L C were the recipients of la Ligue contre le Cancer. P E was supported by ARTP. M B was supported by ARC. We are grateful to the Vector Core of the University Hospital of Nantes, supported by the Association Française contre les Myopathies (AFM) for the production of Adenoviruses. This work was supported by ARC.
Acknowledgements
We thank Dr S Hemmi for kindly providing the CAR antibody and the CAR expression vector. We thank Dr F Asadi for critical reading of the manuscript.
References
Anders M, Christian C, McMahon M, McCormick F & Korn WM 2003 Inhibition of the Raf/MEK/ERK pathway up-regulates expression of the coxsackievirus and adenovirus receptor in cancer cells. Cancer Research 63 2088–2095.
Auer D, Reimer D, Porto V, Fleischer M, Roessler J, Wiedemair A, Marth C, Muller-Holzner E, Daxenbichler G & Zeimet AG 2009 Expression of coxsackie-adenovirus receptor is related to estrogen sensitivity in breast cancer. Breast Cancer Research and Treatment 116 103–111 doi:10.1007/s10549-008-0108-0.
Balda MS & Matter K 2009 Tight junctions and the regulation of gene expression. Biochimica et Biophysica Acta 1788 761–767 doi:10.1016/j.bbamem.2008.11.024.
Bardin A, Boulle N, Lazennec G, Vignon F & Pujol P 2004 Loss of ERbeta expression as a common step in estrogen-dependent tumor progression. Endocrine-Related Cancer 11 537–551 doi:10.1677/erc.1.00800.
Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz MS, Crowell RL & Finberg RW 1997 Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275 1320–1323 doi:10.1126/science.275.5304.1320.
Bruning A & Runnebaum IB 2003 CAR is a cell–cell adhesion protein in human cancer cells and is expressionally modulated by dexamethasone, TNFalpha, and TGFbeta. Gene Therapy 10 198–205 doi:10.1038/sj.gt.3301887.
Bruning A & Runnebaum IB 2004 The coxsackie adenovirus receptor inhibits cancer cell migration. Experimental Cell Research 298 624–631 doi:10.1016/j.yexcr.2004.05.001.
Bruning A, Stickeler E, Diederich D, Walz L, Rohleder H, Friese K & Runnebaum IB 2005 Coxsackie and adenovirus receptor promotes adenocarcinoma cell survival and is expressionally activated after transition from preneoplastic precursor lesions to invasive adenocarcinomas. Clinical Cancer Research 11 4316–4320 doi:10.1158/1078-0432.CCR-04-2370.
Cheng J, Lee EJ, Madison LD & Lazennec G 2004 Expression of estrogen receptor beta in prostate carcinoma cells inhibits invasion and proliferation and triggers apoptosis. FEBS Letters 566 169–172 doi:10.1016/j.febslet.2004.04.025.
Cohen CJ, Gaetz J, Ohman T & Bergelson JM 2001 Multiple regions within the coxsackievirus and adenovirus receptor cytoplasmic domain are required for basolateral sorting. Journal of Biological Chemistry 276 25392–25398 doi:10.1074/jbc.M009531200.
Coyne CB & Bergelson JM 2005 CAR : a virus receptor within the tight junction. Advanced Drug Delivery Reviews 57 869–882 doi:10.1016/j.addr.2005.01.007.
Duong V, Licznar A, Margueron R, Boulle N, Busson M, Lacroix M, Katzenellenbogen BS, Cavailles V & Lazennec G 2006 ERalpha and ERbeta expression and transcriptional activity are differentially regulated by HDAC inhibitors. Oncogene 25 1799–1806 doi:10.1038/sj.onc.1209102.
Glasgow JN, Everts M & Curiel DT 2006 Transductional targeting of adenovirus vectors for gene therapy. Cancer Gene Therapy 13 830–844 doi:10.1038/sj.cgt.7700928.
Gruber CJ, Gruber DM, Gruber IM, Wieser F & Huber JC 2004 Anatomy of the estrogen response element. Trends in Endocrinology and Metabolism 15 73–78 doi:10.1016/j.tem.2004.01.008.
Haviv YS, Blackwell JL, Kanerva A, Nagi P, Krasnykh V, Dmitriev I, Wang M, Naito S, Lei X & Hemminki A et al. 2002 Adenoviral gene therapy for renal cancer requires retargeting to alternative cellular receptors. Cancer Research 62 4273–4281.
Hemmi S, Geertsen R, Mezzacasa A, Peter I & Dummer R 1998 The presence of human coxsackievirus and adenovirus receptor is associated with efficient adenovirus-mediated transgene expression in human melanoma cell cultures. Human Gene Therapy 9 2363–2373 doi:10.1089/hum.1998.9.16-2363.
Hemminki A, Kanerva A, Liu B, Wang M, Alvarez RD, Siegal GP & Curiel DT 2003 Modulation of coxsackie-adenovirus receptor expression for increased adenoviral transgene expression. Cancer Research 63 847–853.
Henderson BE, Ross R & Bernstein L 1988 Estrogens as a cause of human cancer. The Richard and Linda Rosenthal foundation award lecture. Cancer Research 48 246–253.
Huang KC, Altinoz M, Wosik K, Larochelle N, Koty Z, Zhu L, Holland PC & Nalbantoglu J 2005 Impact of the coxsackie and adenovirus receptor (CAR) on glioma cell growth and invasion: requirement for the C-terminal domain. International Journal of Cancer 113 738–745 doi:10.1002/ijc.20623.
Katzenellenbogen BS, Montano MM, Ediger TR, Sun J, Ekena K, Lazennec G, Martini PG, McInerney EM, Delage-Mourroux R & Weis K et al. 2000 Estrogen receptors: selective ligands, partners, and distinctive pharmacology. Recent Progress in Hormone Research 163–193 discussion 194–5.
Kim M, Sumerel LA, Belousova N, Lyons GR, Carey DE, Krasnykh V & Douglas JT 2003 The coxsackievirus and adenovirus receptor acts as a tumour suppressor in malignant glioma cells. British Journal of Cancer 88 1411–1416 doi:10.1038/sj.bjc.6600932.
Kitazono M, Goldsmith ME, Aikou T, Bates S & Fojo T 2001 Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR901228. Cancer Research 61 6328–6330.
Lazennec G 2006 Estrogen receptor beta, a possible tumor suppressor involved in ovarian carcinogenesis. Cancer Letters 231 151–157 doi:10.1016/j.canlet.2005.01.021.
Lazennec G, Kern L, Salbert G, Saligaut D & Valotaire Y 1996 Cooperation between the human estrogen receptor (ER) and MCF-7 cell-specific transcription factors elicits high activity of an estrogen-inducible enhancer from the trout ER gene promoter. Molecular Endocrinology 10 1116–1126 doi:10.1210/me.10.9.1116.
Lazennec G, Alcorn JL & Katzenellenbogen BS 1999 Adenovirus-mediated delivery of a dominant negative estrogen receptor gene abrogates estrogen-stimulated gene expression and breast cancer cell proliferation. Molecular Endocrinology 13 969–980 doi:10.1210/me.13.6.969.
Lazennec G, Bresson D, Lucas A, Chauveau C & Vignon F 2001 ERbeta inhibits proliferation and invasion of breast cancer cells. Endocrinology 142 4120–4130 doi:10.1210/en.142.9.4120.
Li Y, Pong RC, Bergelson JM, Hall MC, Sagalowsky AI, Tseng CP, Wang Z & Hsieh JT 1999 Loss of adenoviral receptor expression in human bladder cancer cells: a potential impact on the efficacy of gene therapy. Cancer Research 59 325–330.
Lucas A, Kremer EJ, Hemmi S, Luis J, Vignon F & Lazennec G 2003 Comparative transductions of breast cancer cells by three DNA viruses. Biochemical and Biophysical Research Communications 309 1011–1016 doi:10.1016/j.bbrc.2003.08.101.
MacCalman CD, Farookhi R & Blaschuk OW 1995 Estradiol regulates N-cadherin mRNA levels in the mouse ovary. Developmental Genetics 16 20–24 doi:10.1002/dvg.1020160106.
Martin TA, Watkins G & Jiang WG 2005 The coxsackie-adenovirus receptor has elevated expression in human breast cancer. Clinical and Experimental Medicine 5 122–128 doi:10.1007/s10238-005-0076-1.
Matsumoto K, Shariat SF, Ayala GE, Rauen KA & Lerner SP 2005 Loss of coxsackie and adenovirus receptor expression is associated with features of aggressive bladder cancer. Urology 66 441–446 doi:10.1016/j.urology.2005.02.033.
Métivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M & Gannon F 2003 Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115 751–763 doi:10.1016/S0092-8674(03)00934-6.
Oesterreich S, Deng W, Jiang S, Cui X, Ivanova M, Schiff R, Kang K, Hadsell DL, Behrens J & Lee AV 2003 Estrogen-mediated down-regulation of E-cadherin in breast cancer cells. Cancer Research 63 5203–5208.
Okegawa T, Li Y, Pong RC, Bergelson JM, Zhou J & Hsieh JT 2000 The dual impact of coxsackie and adenovirus receptor expression on human prostate cancer gene therapy. Cancer Research 60 5031–5036.
Okegawa T, Pong RC, Li Y, Bergelson JM, Sagalowsky AI & Hsieh JT 2001 The mechanism of the growth-inhibitory effect of coxsackie and adenovirus receptor (CAR) on human bladder cancer: a functional analysis of car protein structure. Cancer Research 61 6592–6600.
Okegawa T, Sayne JR, Nutahara K, Pong RC, Saboorian H, Kabbani W, Higashihara E & Hsieh JT 2007 A histone deacetylase inhibitor enhances adenoviral infection of renal cancer cells. Journal of Urology 177 1148–1156 doi:10.1016/j.juro.2006.10.034.
O'Lone R, Frith MC, Karlsson EK & Hansen U 2004 Genomic targets of nuclear estrogen receptors. Molecular Endocrinology 18 1859–1875 doi:10.1210/me.2003-0044.
Pong R-C, Lai Y-J, Chen H, Okegawa T, Frenkel E, Sagalowsky A & Hsieh J-T 2003 Epigenetic regulation of coxsackie and adenovirus receptor (CAR) gene promoter in urogenital cancer cells. Cancer Research 63 8680–8686.
Pong RC, Roark R, Ou JY, Fan J, Stanfield J, Frenkel E, Sagalowsky A & Hsieh JT 2006 Mechanism of increased coxsackie and adenovirus receptor gene expression and adenovirus uptake by phytoestrogen and histone deacetylase inhibitor in human bladder cancer cells and the potential clinical application. Cancer Research 66 8822–8828 doi:10.1158/0008-5472.CAN-05-4672.
Prall OW, Rogan EM & Sutherland RL 1998 Estrogen regulation of cell cycle progression in breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 65 169–174 doi:10.1016/S0960-0760(98)00021-1.
Qin M, Escuadro B, Dohadwala M, Sharma S & Batra RK 2004 A novel role for the coxsackie adenovirus receptor in mediating tumor formation by lung cancer cells. Cancer Research 64 6377–6380 doi:10.1158/0008-5472.CAN-04-1490.
Sachs MD, Rauen KA, Ramamurthy M, Dodson JL, De Marzo AM, Putzi MJ, Schoenberg MP & Rodriguez R 2002 Integrin alpha(v) and coxsackie adenovirus receptor expression in clinical bladder cancer. Urology 60 531–536 doi:10.1016/S0090-4295(02)01748-X.
Santen R, Manni A, Harvey H & Redmond C 1990 Endocrine treatment of breast cancer in women. Endocrine Reviews 11 221–265 doi:10.1210/edrv-11-2-221.
Thoelen I, Magnusson C, Tagerud S, Polacek C, Lindberg M & Van Ranst M 2001 Identification of alternative splice products encoded by the human coxsackie-adenovirus receptor gene. Biochemical and Biophysical Research Communications 287 216–222 doi:10.1006/bbrc.2001.5535.
Tsukita S, Yamazaki Y, Katsuno T, Tamura A & Tsukita S 2008 Tight junction-based epithelial microenvironment and cell proliferation. Oncogene 27 6930–6938 doi:10.1038/onc.2008.344.
Veena MS, Qin M, Andersson A, Sharma S & Batra RK 2009 CAR mediates efficient tumor engraftment of mesenchymal type lung cancer cells. Laboratory Investigation 89 875–886 doi:10.1038/labinvest.2009.56.
Wang B, Chen G, Li F, Zhou J, Lu Y & Ma D 2005 Inhibitory effect of coxsackie adenovirus receptor on invasion and metastasis phenotype of ovarian cancer cell line SKOV3. Journal of Huazhong University of Science and Technology. Medical Sciences 25 85–87, 93 doi:10.1007/BF02831395.
Zhang LL, He DL, Li X, Li L, Zhu GD, Zhang D & Wang XY 2007 Overexpression of coxsackie and adenovirus receptor inhibit growth of human bladder cancer cell in vitro and in vivo. Acta Pharmacologica Sinica 28 895–900 doi:10.1111/j.1745-7254.2007.00574.x.
