Thyroid hormones and tetrac: new regulators of tumour stroma formation via integrin αvβ3

in Endocrine-Related Cancer
Authors:
Kathrin A Schmohl Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Kathrin A Schmohl in
Current site
Google Scholar
PubMed
Close
,
Andrea M Müller Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Andrea M Müller in
Current site
Google Scholar
PubMed
Close
,
Alexandra Wechselberger Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Alexandra Wechselberger in
Current site
Google Scholar
PubMed
Close
,
Svenja Rühland Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany
Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Svenja Rühland in
Current site
Google Scholar
PubMed
Close
,
Nicole Salb Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Nicole Salb in
Current site
Google Scholar
PubMed
Close
,
Nathalie Schwenk Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Nathalie Schwenk in
Current site
Google Scholar
PubMed
Close
,
Heike Heuer Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Heike Heuer in
Current site
Google Scholar
PubMed
Close
,
Janette Carlsen Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Janette Carlsen in
Current site
Google Scholar
PubMed
Close
,
Burkhard Göke Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany
Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Burkhard Göke in
Current site
Google Scholar
PubMed
Close
,
Peter J Nelson Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Peter J Nelson in
Current site
Google Scholar
PubMed
Close
, and
Christine Spitzweg Department of Internal Medicine II, Medizinische Klinik und Poliklinik IV, Department of Biology II, Leibniz Institute for Environmental Medicine, Department of Nuclear Medicine, University Medical Center Hamburg‐Eppendorf, University Hospital of Munich, Munich, Germany

Search for other papers by Christine Spitzweg in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

To improve our understanding of non-genomic, integrin αvβ3-mediated thyroid hormone action in tumour stroma formation, we examined the effects of triiodo-l-thyronine (T3), l-thyroxine (T4) and integrin-specific inhibitor tetrac on differentiation, migration and invasion of mesenchymal stem cells (MSCs) that are an integral part of the tumour's fibrovascular network. Primary human bone marrow-derived MSCs were treated with T3 or T4 in the presence of hepatocellular carcinoma (HCC) cell-conditioned medium (CM), which resulted in stimulation of the expression of genes associated with cancer-associated fibroblast-like differentiation as determined by qPCR and ELISA. In addition, T3 and T4 increased migration of MSCs towards HCC cell-CM and invasion into the centre of three-dimensional HCC cell spheroids. All these effects were tetrac-dependent and therefore integrin αvβ3-mediated. In a subcutaneous HCC xenograft model, MSCs showed significantly increased recruitment and invasion into tumours of hyperthyroid mice compared to euthyroid and, in particular, hypothyroid mice, while treatment with tetrac almost completely eliminated MSC recruitment. These studies significantly improve our understanding of the anti-tumour activity of tetrac, as well as the mechanisms that regulate MSC differentiation and recruitment in the context of tumour stroma formation, as an important prerequisite for the utilisation of MSCs as gene delivery vehicles.

Abstract

To improve our understanding of non-genomic, integrin αvβ3-mediated thyroid hormone action in tumour stroma formation, we examined the effects of triiodo-l-thyronine (T3), l-thyroxine (T4) and integrin-specific inhibitor tetrac on differentiation, migration and invasion of mesenchymal stem cells (MSCs) that are an integral part of the tumour's fibrovascular network. Primary human bone marrow-derived MSCs were treated with T3 or T4 in the presence of hepatocellular carcinoma (HCC) cell-conditioned medium (CM), which resulted in stimulation of the expression of genes associated with cancer-associated fibroblast-like differentiation as determined by qPCR and ELISA. In addition, T3 and T4 increased migration of MSCs towards HCC cell-CM and invasion into the centre of three-dimensional HCC cell spheroids. All these effects were tetrac-dependent and therefore integrin αvβ3-mediated. In a subcutaneous HCC xenograft model, MSCs showed significantly increased recruitment and invasion into tumours of hyperthyroid mice compared to euthyroid and, in particular, hypothyroid mice, while treatment with tetrac almost completely eliminated MSC recruitment. These studies significantly improve our understanding of the anti-tumour activity of tetrac, as well as the mechanisms that regulate MSC differentiation and recruitment in the context of tumour stroma formation, as an important prerequisite for the utilisation of MSCs as gene delivery vehicles.

Introduction

Tumours are composed of malignant tumour cells and the ‘benign’ stromal compartment that contains many distinct cell types, including endothelial cells, smooth muscle cells, cells of the immune system and pericytes/cancer-associated fibroblasts (CAFs) (Spaeth et al. 2008, Dwyer et al. 2010). As the tumour stroma plays a key role in cancer progression with effects on tumour cell proliferation, angiogenesis and metastasis, it has become an attractive target for tumour therapy. Thus, understanding the biology of the tumour microenvironment is becoming as important as knowledge of the neoplastic epithelial cells themselves.

Mesenchymal stem cells (MSCs) are multipotent non-haematopoietic progenitor cells that are characterised by their capacity to self-renew and differentiate into cells of connective tissue lineages such as bone, cartilage, muscle and adipose tissue (Klopp et al. 2007, Dwyer & Kerin 2010). In the course of tissue injury or during chronic inflammation, MSCs contribute to tissue remodelling by their mobilisation and subsequent recruitment to the site of injury (Klopp et al. 2007, Dwyer & Kerin 2010). Similarities between the wound-healing process and tumour stroma formation have led to the suggestion that tumours are ‘wounds that do not heal’ (Dvorak 1986). We and others have shown that MSCs are actively recruited to growing tumour stroma (Conrad et al. 2007, Zischek et al. 2009, Conrad et al. 2011, Knoop et al. 2011, Niess et al. 2011, Knoop et al. 2013) mediated by high local concentrations of inflammatory chemokines and growth factors (Ponte et al. 2007, Spaeth et al. 2008, Dwyer & Kerin 2010, Kholodenko et al. 2013). This tumour tropism constitutes the basis for the ‘Trojan horse’ approach, in which MSCs are used as shuttle vectors to deliver therapeutic agents into growing tumours (Dwyer & Kerin 2010, Dwyer et al. 2010, Dwyer et al. 2011, Dembinski et al. 2013, Zhu et al. 2014, Zhang et al. 2015), as we have successfully demonstrated in our previous work using the sodium iodide symporter (NIS) (Knoop et al. 2011, Knoop et al. 2013, Knoop et al. 2015) and herpes simplex virus type 1 thymidine kinase (HSV-TK) (Zischek et al. 2009, Conrad et al. 2011, Niess et al. 2011) as therapy genes in various tumour models.

Upon homing, MSCs act as important progenitors to subtypes that comprise the tumour stroma, including cells of the tumour vasculature and CAF-like cells (Barcellos-de-Souza et al. 2013). A CAF-like phenotype is defined by the following sets of markers: i) fibroblast surface markers; ii) indicators of tissue remodelling and invasion; iii) markers of angiogenesis; and iv) tumour promoting growth factors (Mishra et al. 2008, Spaeth et al. 2009, Kidd et al. 2012). While it is now well established that MCSs play a major role in supporting tumour vasculature and forming the tumour's fibrovascular network, the exact mechanisms behind their migration and differentiation in the tumour microenvironment and their impact on tumour progression are not yet fully understood.

Thyroid hormones 3,3′,5-triiodo-l-thyronine (T3) and l-thyroxine (T4) are regulators of differentiation, growth and metabolism in most healthy tissues, but they have also been proposed to play a critical role in tumour stroma formation by stimulation of angiogenesis, proliferation and inflammation (Luidens et al. 2010, Davis et al. 2011). These effects have been shown to be transduced by non-genomic mechanisms via a plasma membrane receptor for thyroid hormone on integrin αvβ3 that was identified in 2005 by P J Davis and colleagues (Bergh et al. 2005). Integrin αvβ3 is predominantly concentrated in the plasma membrane of endothelial cells, vascular smooth muscle cells, osteoclasts and cancer cells, and is an attractive target for attempts to manipulate tumour cell proliferation and tumour-related neovascularisation (Davis et al. 2009). Tetraiodothyroacetic acid (tetrac), a deaminated T4 derivative, is a specific inhibitor of thyroid hormone action at the integrin site (Bergh et al. 2005, Davis et al. 2011).

There is growing evidence that iodothyronines act as ‘non-classical’ pro-angiogenic modulators and induce neovascularisation. Pro-angiogenic actions of T3 and T4 are initiated at the hormone receptor on integrin αvβ3, transduced by the MAPK/ERK pathway, and involve effects on basic fibroblast growth factor (FGF2), vascular endothelial growth factor (VEGF) and epidermal growth factor (EGF) secretion (Luidens et al. 2010, Pinto et al. 2011). As an inhibitor of T3/T4 binding to αvβ3, tetrac has been shown to inhibit angiogenic activity of thyroid hormones. In addition, αvβ3-mediated proliferative activity of T3 and T4 has been reported in various cancer cell lines. A recent uncontrolled observational study suggests that lowering of circulating T4 levels is correlated with prolonged survival of terminal stage cancer patients (Hercbergs et al. 2015). In contrast, tetrac exerts a tumour growth-inhibitory effect based on the inhibition of T3/T4 effects, but also on agonist-independent direct anti-angiogenic and pro-apoptotic effects (Davis et al. 2011, Yalcin et al. 2013). In this context, an array of genes has been identified in human cancer cells that are regulated by tetrac through αvβ3. This regulation includes stimulation of pro-apoptosis genes and downregulation of proto-oncogenes, cyclin genes, the EGFR gene, as well as genes in the Wnt/β-catenin pathway, such as CTNNA1 and CTNNA2 (Davis et al. 2014).

MSCs are key players in the tumour microenvironment, and thyroid hormones have been shown to play a critical role in the regulation of tumour stoma formation. Therefore, in the current study we sought to investigate the non-genomic effects of T3, T4 and tetrac on important aspects of MSC biology in the tumour milieu, such as differentiation, migration, recruitment and invasion as a critical prerequisite for the application of MSCs as gene delivery vehicles.

Materials and methods

Cell lines

Primary human bone marrow-derived CD34-negative MSCs (either prepared in house or provided by Apceth, Munich, Germany) were isolated and characterised according to the minimal criteria for MSCs released by the International Society for Cellular Therapy (Dominici et al. 2006). MSCs were used from passage 2 to 8 for experiments. The integrin αvβ3-negative human hepatocellular carcinoma (HCC) cell line HuH7 was authenticated and purchased from JCRB Cell Bank (Osaka, Japan) and passaged up to ten times in our laboratories. Both cell lines were grown in DMEM (Sigma–Aldrich) containing 10% (v/v) fetal bovine serum (FBS; FBS Superior, Biochrom/Merck Millipore, Berlin, Germany), 100 U/ml penicillin/100 μg/ml streptomycin (Sigma–Aldrich) and 2 mM l-glutamine (Sigma–Aldrich) and maintained at 37 °C in a humidified 5% (v/v) CO2 atmosphere.

Thyroid hormone treatment in vitro

T3, T4 and tetrac were dissolved in 0.1 N NaOH at 1 mg/ml. 25 μM (T3 and T4) or 100 μM (tetrac) stock solutions were prepared in sterile culture medium and stored in working aliquots at −20 °C protected from light. For the preparation of conditioned medium (CM), HuH7 were grown for 48 h to 80% confluence in DMEM containing 10% (v/v) charcoal-stripped FBS (csFBS; T3: <0.2 pg/ml, T4: 0.2–0.6 ng/dl). Supernatant was removed and centrifuged to eliminate cell debris. Prior to thyroid hormone treatment, MSCs were grown in DMEM/csFBS for 24 h. Medium was changed to 80% (v/v) DMEM/csFBS and 20% (v/v) HuH7 CM for differentiation studies or DMEM/csFBS for migration and invasion studies and supplemented with 1 nM T3 or 1 μM T4 with and without 100 nM tetrac for 24 h. In a pilot study, ranges of 1–100 nM T3 as well as 1–1000 nM T4 were tested and optimal concentrations of 1 nM total T3 (∼30 pM free T3) and 1 μM total T4 (∼1.5 nM free T4) were used for further experiments.

Flow cytometry

For flow cytometry, MSCs and HuH7 were harvested with EDTA (Sigma–Aldrich) and washed with PBS (Sigma–Aldrich) supplemented with 10% (v/v) FBS (FACS buffer). Cells were incubated with a mouse monoclonal anti-integrin αvβ3 antibody (2 μg/106 cells; Abcam, Cambridge, UK) for 45 min on ice, washed with FACS buffer and then incubated with a Cy3-conjugated polyclonal donkey anti-mouse antibody (2 μg/106 cells; Jackson, Baltimore, MD, USA) for 30 min on ice. Cells incubated without the primary antibody served as negative control. Analysis was performed in the FL2 channel of a BD Accuri C6 flow cytometer using Cflow software (BD Biosciences, Franklin Lakes, NJ, USA). 105 events were recorded for each sample. Cell debris was excluded from analysis by appropriate gating.

Quantitative real-time PCR

Total RNA from MSCs was prepared using the RNeasy Mini Kit with QIAshredder (Qiagen). RT and quantitative real-time PCR were performed as described previously (Knoop et al. 2013) and run in a Mastercycler ep gradient S PCR cycler (Eppendorf, Hamburg, Germany). Relative expression levels were calculated from ΔΔCt values normalised to internal β-actin and 18S rRNA. Primers are listed in Table 1.

Table 1

qPCR primer sequences

GeneForward primer (5′→3′)Reverse primer (5′→3′)
ACTA2 (α-SMA)ACCCACAATGTCCCCATCTAGAAGGAATAGCCACGCTCAG
ACTB (β-actin)AGAAAATCTGGCACCACACCTAGCACAGCCTGGATAGCAA
CXCL12 (SDF-1)AGAGCCAACGTCAAGCATCTCTTTAGCTTCGGGTCAATGC
DES (desmin)AAGCTGCAGGAGGAGATTCAGGCAGTGAGGTCTGGCTTAG
EGFCAGGGAAGATGACCACCACTCAGTTCCCACCACTTCAGGT
FAPGGTCTCCCAACAAAGGATGACATTGCCTGGAAATCCACTT
FGF2GGAGAAGAGCGACCCTCACAGCCAGGTAACGGTTAGCAC
HGFCTGGTTCCCCTTCAATAGCACTCCAGGGCTGACATTTGAT
IL6TACCCCCAGGAGAAGATTCCTTTTCTGCCAGTGCCTCTTT
MMP3 (SL-1)GCAGTTTGCTCAGCCTATCCGAGTGTCGGAGTCCAGCTTC
R18sCAGCCACCCGAGATTGAGCATAGTAGCGACGGGCGGTGTG
S100A4 (FSP1)CCCTGGATGTGATGGTGTCCCGATGCAGGACAGGAAGACA
TGFB1 (TGF-β1)CAGCACGTGGAGCTGTACCAAGATAACCACTCTGGCGAGTC
THBS1 (TSP1)TTGTCTTTGGAACCACACCACTGGACAGCTCATCACAGGA
TNCTTCACTGGAGCTGACTGTGGTAGGGCAGCTCATGTCACTG
VEGFCTACCTCCACCATGCCAAGTATGATTCTGCCCTCCTCCTT

ELISA

Supernatant from MSCs was removed, centrifuged and stored at −80 °C until assayed for EGF, FGF2, hepatocyte growth factor (HGF), interleukin 6 (IL6), stromal-derived factor 1 (SDF-1), transforming growth factor beta1 (TGF-β1), thrombospondin 1 (TSP1) and VEGF concentrations using the respective DuoSet ELISA kit (R&D Systems, Abingdon, UK). Contributions from medium and HuH7 CM were subtracted.

Migration assay

MSC migration was analysed using the μ-slide Chemotaxis3D system from ibidi (Martinsried, Germany). MSCs were seeded in collagen I (0.3×106 cells/ml) and subjected to a gradient between serum-free unconditioned medium and serum-free HuH7 CM. Both media and the collagen gel contained either no thyroid hormone, 1 nM T3 or 1 μM T4 with and without 100 nM tetrac. Chemotaxis was monitored by time-lapse microscopy over a 24-h period on a Leica DM IL microscope (Leica Microsystems, Wetzlar, Germany). Pictures were taken every 15 min with a Jenoptik ProgRes CCD camera (Jenoptik, Jena, Germany) controlled by the open-source ImageJ (NIH, Bethesda, MD, USA) plug-in μManager (Edelstein et al. 2010). Twenty-five randomly selected cells were manually tracked with the ImageJ plug-in Manual Tracking (Fabrice Cordelières, Orsay, France) and analysed with Chemotaxis and Migration Tool Software (ibidi). The migratory behaviour of cells was quantified by forward migration index (FMI), a measure of the efficiency of the migration of cells in relation to the CM gradient and centre-of-mass (CoM) displacement that is calculated from the averaged point of all cell endpoints.

Spheroid invasion assay

Invasion assays were performed as described previously (Huisken et al. 2004, Pitrone et al. 2013, Gualda et al. 2014, Rühland et al. 2015). In brief, spheroids of 200–300 μm in diameter were grown from HuH7 cells. Single spheroids were rolled in 2.5×104 thyroid hormone-treated, CellTracker Green CMFDA- (5-chloromethylfluorescein diacetate, Life Technologies) labelled MSCs for 2 h, washed and incubated for further 24 h. Spheroids were fixed in 4% formalin, embedded in 1% (w/v) 2-hydroxyethylagarose (Roth, Karlsruhe, Germany) containing green fluorescent microspheres (F-XC 50 Estapor, Merck; 1:50 000 dilution) and aspirated into a glass capillary. Imaging was performed with a 488 nm laser (2 mW laser power, 120 ms exposure time; Cube, Coherent, Santa Clara, CA, USA) and an sCMOS camera (Orca-flash 4.0 V2, Hamamatsu, Hamamatsu City, Japan) from five different angles equally spaced over 360°, controlled via the FIJI μManager plug-in (Edelstein et al. 2010). The subsequent registration of beads and fusion of images was performed using SPIM open-source software on FIJI (Preibisch et al. 2010). Signals from CMFDA-labelled MSCs and the autofluorescent spheroid were detected and segmented using the FIJI 3D object counter plugin (Bolte & Cordelieres 2006). Invasion depths were quantified by measurement of distances from the centre of each MSC to the border of the spheroid using the FIJI 3D manager plugin (Ollion et al. 2013).

Animals

Male CD1 nu/nu mice from Charles River (Sulzfeld, Germany) were maintained under specific pathogen-free conditions with access to standard nude mouse diet (ssniff, Soest, Germany) and water ad libitum. Animals were allowed to acclimatise for 1 week prior to the start of treatments. Experiments were conducted with animals between 5 and 12 weeks of age. Thyroid hormone status was regularly monitored in serum samples as described previously (Schmohl et al. 2015). The experimental protocol was approved by the regional governmental commission for animals (Regierung von Oberbayern, Munich, Germany).

MSC recruitment to tumours in vivo

HuH7 xenograft tumours were established by s.c. injection of 3.5×106 HuH7 cells in 100 μl PBS into the flank region. Three days later, animals received drinking water supplemented with 0.02% (w/v) 2-mercapto-1-methylimidazole (MMI; Sigma–Aldrich), 1% (w/v) sodium perchlorate (Sigma–Aldrich) and 0.3% (w/v) saccharin (Sigma–Aldrich) (Groba et al. 2013) to induce hypothyroidism in order to generate the same baseline thyroid hormone levels for all groups. Three weeks later, once small tumours (<3 mm) were visible, mice were randomly assigned to different groups by daily i.p. injections. The hyperthyroid group (n=8) received 100 ng/g body weight l-T4 (Sigma–Aldrich), the euthyroid group 20 ng/g body weight l-T4 with (n=8) or without (n=7) 10 μg/g body weight tetrac (Sigma–Aldrich), hypothyroid animals (n=8) received saline only. Eighteen days later (tumour volume ∼500 mm3), 5×105 MSCs cytoplasmically labelled with 20 μM CMFDA for 30 min were injected via the tail vein in 500 μl PBS. Seventy-two hours later, mice were sacrificed and tumours were embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Alphen aan den Rijn, the Netherlands), snap-frozen on dry ice and stored at −80 °C.

Immunofluorescence microscopy

Tissue sections were fixed in methanol/acetone, counterstained with 5 μg/ml bisbenzimide Hoechst 33258 (Sigma–Aldrich), mounted with Dako Fluorescence Mounting Medium (Dako, Carpinteria, CA, USA) and imaged at 10× magnification on an Axiovert 135 TV fluorescence microscope equipped with an AxioCam MRm CCD camera and AxioVision Rel. 4.8 Software (Carl Zeiss, Munich, Germany). Four to seven visual fields in perivascular regions were recorded per animal and MSC recruitment was quantified as a percentage of CMFDA-positive area using ImageJ software (NIH, Bethesda, MD, USA).

Statistics

All in vitro experiments were performed at least in triplicate. In vivo data were generated in two independent experiments. Values are reported as mean±s.e.m. or mean fold change±s.e.m. Statistical significance was tested by two-tailed Student's t-test or, for invasion assays, by Kruskal–Wallis test. P-values <0.05 were considered significant (*P<0.05; **P<0.01; ***P<0.001).

Results

Expression of integrin αvβ3 is absent on HuH7 cells and not influenced by thyroid hormones T3 and T4 or tetrac on MSCs

Absence of integrin αvβ3 expression on HuH7, as well as presence of αvβ3 on MSCs, was confirmed by flow cytometry (Fig. 1). Treatment of MSCs with 1 nM T3 or 1 μM T4 in the presence or absence of tetrac (100 nM) or tetrac alone did not alter expression levels of the integrin (Fig. 1).

Figure 1
Figure 1

Evaluation of integrin αvβ3 expression on HuH7 and MSCs. MSCs were treated with HuH7 CM alone or in the presence of 1 nM T3 or 1 μM T4 with or without 100 nM tetrac, or in the presence of tetrac alone for 24 h. HuH7 and MSCs were analysed for integrin αvβ3 expression by flow cytometry. A representative image from three experiments is shown.

Citation: Endocrine-Related Cancer 22, 6; 10.1530/ERC-15-0245

Thyroid hormones T3 and T4 increase CAF-like differentiation of MSCs in vitro

Twenty-four-hour stimulation of MSCs with HuH7 CM in the presence of 1 nM T3 or 1 μM T4 resulted in significantly increased mRNA levels for genes associated with a CAF-like phenotype. Upon T3 treatment, surface marker fibroblast-specific protein 1 (FSP1; S100A4), markers of angiogenesis desmin and VEGF, as well as tumour-promoting growth factors EGF, FGF2, HGF, IL6, SDF-1 and TGF-β1, were expressed at significantly higher mRNA levels as compared to control cells treated with HuH7 CM alone. Surface marker fibroblast activation protein (FAP), indicators of tissue remodelling and invasion tenascin-C (TN-C) and TSP1 (THBS1), as well as the angiogenesis marker alpha-smooth muscle actin (α-SMA; ACTA2), showed the same trend that was, however, not significant (Fig. 2A). T4 stimulation led to significant increases in mRNA expression for FAP, TN-C, TSP1, α-SMA and desmin, as well as FGF2, IL6, SDF-1 and TGF-β1, while the same, albeit not significant, trends were seen for FSP1, VEGF, EGF and HGF (Fig. 2B). The marker of invasion and remodelling stromelysin-1 (SL-1/MMP3) was not detected for any of the conditions tested (not shown). Effects seen at the mRNA level were confirmed at the protein level for TSP1, VEGF, IL6, SDF-1 and TGF-β1 by ELISA (Fig. 2C). Protein levels for EGF, FGF2 and HGF remained below the detection limit of the ELISA kits used for all treatment conditions. The T3- and T4-triggered increases in gene and protein concentrations were found to be tetrac-dependent and therefore αvβ3-mediated. No significant changes were observed when cells were treated with tetrac alone (data not shown).

Figure 2
Figure 2

Expression of CAF-like markers in MSCs is stimulated by thyroid hormones T3 and T4 via integrin αvβ3. MSCs were treated with HuH7 CM alone (grey line) or in the presence of 1 nM T3 or 1 μM T4 with or without 100 nM tetrac, or in the presence of tetrac alone for 24 h. Expression of CAF-like markers was assessed at the mRNA level by qPCR ((A) T3, (B) T4) and at the protein level by ELISA (C). Results are expressed as mean fold change compared to control cells treated with HuH7 CM only (n=4; two-tailed Student's t-test: *P<0.05; **P<0.01; ***P<0.001).

Citation: Endocrine-Related Cancer 22, 6; 10.1530/ERC-15-0245

Thyroid hormones T3 and T4 increase migration of MSCs towards tumour signals

MSCs subjected to a gradient between HuH7 CM and serum-free medium showed directed chemotaxis towards CM with significantly increased FMI and CoM displacement along the gradient of 0.227±0.041 (P<0.001) and 84.7±18.8 μm (P<0.001) respectively (Fig. 3B, H and I) compared to untreated cells not subjected to a gradient that showed basal random chemokinesis (FMI −0.060±0.025 and CoM −26.8±11.3 μm; Fig. 3A). This set-up was used to analyse the effects of T3, T4 and tetrac on the migratory behaviour of MSCs towards HuH7 CM. MSCs were pretreated with thyroid hormone with or without tetrac for 24 h and kept under the same T3/T4/tetrac concentrations throughout the chemotaxis assay. Migration of MSCs towards CM was significantly increased upon treatment with 1 nM T3 (FMI: 0.383±0.049; P<0.05 and CoM 167.3±21.2 μm; P<0.05; Fig. 3D, H and I) or 1 μM T4 (FMI: 0.345±0.032; P<0.05 and CoM 160.0±12.8 μm; P<0.01; Fig. 3F, H and I) compared to untreated control cells. Additional treatment with 100 nM tetrac inhibited the effects of T3 and T4 respectively on MSC migration (T3+tetrac: FMI: 0.219±0.023; P<0.05 vs T3 and CoM 102.5±13.8 μm; P<0.05 vs T3; Fig. 3E, H and I; T4+tetrac: FMI: 0.261±0.029; P=0.055 vs T4 and CoM 127.9±19.2 μm; P=0.16 vs T4; Fig. 3G, H and I). Cells treated with tetrac alone showed no significant change in migratory behaviour compared to control cells (FMI: 0.275±0.049; P=0.47 and CoM 106.3±19.4 μm; P=0.44; Fig. 3C).

Figure 3
Figure 3

Migration of MSCs towards tumour cell CM is increased upon T3 and T4 treatment mediated by integrin αvβ3. (A) Representative trajectories of untreated MSCs without gradient influence. (B, C, D, E, F and G) Representative trajectories of MSCs treated with 1 nM T3 or 1 μM T4 with or without 100 nM tetrac or with tetrac alone for 24 h migrating along a linear gradient of HuH7 CM over 24 h compared to untreated control cells from six independent experiments. Centres of mass are indicated by red dots. (H, I) Quantification of chemotaxis parameters FMI and CoM (two-tailed Student's t-test: *P<0.05; **P<0.01).

Citation: Endocrine-Related Cancer 22, 6; 10.1530/ERC-15-0245

Thyroid hormones T3 and T4 increase invasion of MSCs into tumour cell spheroids

The invasive capacity of MSCs was evaluated in a three-dimensional HuH7 spheroid model. MSCs were pretreated with 1 nM T3 or 1 μM T4 in the presence or absence of 100 nM tetrac before attaching to spheroids. Both after T3 (Fig. 4B) and T4 stimulation (Fig. 4D), MSCs showed deeper invasion (T3: 34.5±7.42 μm; P=0.15 and T4: 29.00±1.37 μm; P<0.01) into the centre of spheroids compared to untreated control cells (21.83±1.79 μm; Fig. 4A and F). Cells treated with T3 or T4 in the presence of tetrac (T3+tetrac: 9.00±1.78 μm; P<0.05 vs T3 and T4+tetrac: 22.25±1.55 μm; P<0.01 vs T4) showed inhibition of invasion and remained at the surface (Fig. 4C, E and F). In some cases, especially after T3 treatment, invaded cells clustered inside the spheroid and could not be resolved to single cells. Clusters (marked by asterisks in Fig. 4F) were therefore counted as single cells.

Figure 4
Figure 4

Deeper invasion of MSCs into 3D HuH7 spheroids upon T3 and T4 treatment is reversed upon additional treatment with tetrac. (A, B, C, D and E) Representative images of CMFDA-labelled MSCs (green) treated with 1 nM T3 or 1 μM T4 with or without 100 nM tetrac for 24 h invading into HuH7 spheroids (blue). (F) Quantification of invasion depths in distance from surface of the spheroid (n=3; Kruskal–Wallis test: **P<0.01). Cell clusters are indicated by asterisks.

Citation: Endocrine-Related Cancer 22, 6; 10.1530/ERC-15-0245

T4 increases tumour migration and invasion in vivo

To assess the effect of thyroid hormone status and tetrac on MSC recruitment and invasion into tumours in vivo, nude mice harbouring HuH7 xenografts were subjected to different thyroid hormone treatments (euthyroid, hyperthyroid, hypothyroid and euthyroid+tetrac; for serum thyroid hormone concentrations see Supplementary Figure 1, see section on supplementary data given at the end of this article) and, 72 h before sacrifice, were systemically injected with 5×105 CMFDA-labelled MSCs. Immunofluorescence microscopy (Fig. 5A) revealed significantly increased recruitment of MSCs to perivascular regions in the tumour and invasion into the surrounding tumour tissue in hyperthyroid mice (CMFDA positive area 25.7±2.1%; P<0.001; Fig. 5B) compared to euthyroid mice (CMFDA positive area 12.2±1.0%; Fig. 5B). In hypothyroid mice, recruitment and invasion were strikingly reduced (CMFDA positive area 6.7±0.7%; P<0.001; Fig. 5B). Treatment of euthyroid mice with tetrac resulted in an additional reduction in MSC recruitment, revealing only a thin margin of MSCs surrounding blood vessels and no detectable tissue invasion (CMFDA positive area 2.0±0.2%; P<0.001; Fig. 5B). Neither thyroid hormone status nor tetrac treatment had a significant effect on tumour growth in this model (data not shown).

Figure 5
Figure 5

Thyroid hormone status significantly influences MSC recruitment into tumours in vivo. In a HuH7 tumour xenograft model, mice were injected daily with 20 ng/g body weight l-T4 (euthyroid; n=7), 100 ng/g body weight l-T4 (hyperthyroid; n=8), saline (hypothyroid; n=8) or 20 ng/g body weight l-T4+10 μg/g body weight tetrac (euthyroid+tetrac; n=8). 72 h before sacrifice, 5×105 CMFDA-labelled MSCs were injected i.v. Frozen tumour sections were counterstained with Hoechst dye and imaged by fluorescence microscopy. (A) One representative image is shown per group. Magnification: 10×, scale bar=100 μm. (B) Quantification of MSC recruitment to tumours depicted as mean values of CMFDA positive area in % for each group (two-tailed Student's t-test: ***P<0.001).

Citation: Endocrine-Related Cancer 22, 6; 10.1530/ERC-15-0245

Discussion

Based on the fact that both MSCs and thyroid hormones impact crucial steps of tumour stroma formation (Davis et al. 2011, Barcellos-de-Souza et al. 2013), we investigated the regulation of MSC biology in the tumour microenvironment by non-genomic effects of T3, T4 and tetrac. To distinguish between the effects on MSCs/stroma biology as opposed to direct effects on the tumour, we selected an αvβ3-negative HCC as an experimental model (Jin et al. 2012).

First, we addressed the question as to whether thyroid hormones can enhance the CAF-like phenotype that MSCs acquire when exposed to tumour cell-CM (Mishra et al. 2008, Spaeth et al. 2009, Barcellos-de-Souza et al. 2013). Compared to MSCs treated with HuH7 CM alone, upon additional treatment with T3 or T4, we observed an overall enhanced expression of i) fibroblast surface markers FAP and FSP; ii) indicators of tissue remodelling and invasion TN-C and TSP1; iii) proteins associated with angiogenesis α-SMA, desmin and VEGF; and iv) tumour-promoting growth factors/chemokines EGF, FGF2, HGF, IL6, SDF-1 and TGF-β1, suggesting a T3/T4-enhanced CAF-like differentiation of MSCs mediated through αvβ3 as shown by inhibition of these effects by tetrac.

In line with our observations, transduction of the thyroid hormone signal via integrin αvβ3 was shown to lead to transcription of angiogenesis-relevant genes FGF2 and VEGF in the chorioallantoic membrane (CAM) model, as well as in heart and T-cell lymphoma (Luidens et al. 2010, Cayrol et al. 2015). A direct effect of thyroid hormones on inflammatory mediators such as IL6 has been tentatively proposed based on the inhibition of pro-inflammatory cytokines by the iodothyronine antagonist tetrac (Hercbergs et al. 2012). Integrin αvβ3 has been shown to engage in crosstalk with tyrosine kinase growth factor receptors such as EGF receptor, FGF receptor, platelet-derived growth factor (PDGF) receptor and VEGF receptor, which are all expressed by MSCs (Spaeth et al. 2008, Davis et al. 2011, Hercbergs et al. 2012). Explanations for the changes in the expression levels of markers of CAF-like differentiation shown here could involve binding of CM-derived growth factors to their respective receptors on MSCs or autocrine stimulation by growth factors secreted by MSCs in response to CM, with potentiation of the signal through integrin αvβ3 crosstalk. A further indirect effect could involve an enhanced expression of hypoxia-inducible factor 1 alpha (HIF-1α) that was shown to be increased upon T3 binding to integrin αvβ3 transduced by the phosphoinositide 3-kinase (PI3K) pathway, which in turn stimulates the secretion of HIF-responsive genes, such as VEGF, FGF2, IL6, SDF1 and TGFB1 (Davis et al. 2011, Hercbergs et al. 2012). However, the exact mechanisms behind the synergistic effects of CM and T3/T4 on MSC differentiation remain to be elucidated.

In addition, we observed enhanced chemotaxis of MSCs towards tumour signals and invasion into three-dimensional HCC cell spheroids under thyroid hormone stimulation, mediated by αvβ3. Balzan et al. (2013) reported similar effects on microvascular endothelial cells in a wound-healing assay with increased migration after T3 or T4 stimulation that was abolished by treatment with tetrac. Studies on multiple myeloma cells and bone marrow aspirates from multiple myeloma patients by Cohen et al. (2014) illustrate thyroid hormone-dependent, αvβ3-mediated regulation of cell migration. Furthermore, there is growing evidence that thyroid hormones increase the motility of αvβ3-expressing immune cells, and, possibly by similar mechanisms, nerve cell migration (De Vito et al. 2012). An array of growth factors, including PDGF, insulin-like growth factor 1 (IGF1), HGF, EGF and VEGF, as well as chemokines, such as RANTES/CCL5, CCL22 and, to a lower extent, SDF-1/CXCL12 and their respective receptors, have been implicated in MSC migration (Ponte et al. 2007, Spaeth et al. 2008) and many of these have been shown in this and other studies to be regulated by thyroid hormones via differential gene expression and receptor crosstalk (Davis et al. 2011, Hercbergs et al. 2012).

Modulation of recruitment and engraftment efficiency of MSCs is of clinical interest, in settings of tissue regeneration, in the context of general tumour growth and the emerging field of MSC-based gene delivery in cancer therapy (Knoop et al. 2011, Knoop et al. 2013, Uchibori et al. 2014). As the tumour stroma plays such a key role in tumour growth, angiogenesis and metastatic potential, it has become an important target for tumour therapy. Due to their natural tropism for solid tumours and metastases, as well as their relative ease of engineering and expansion in vitro, MSCs are excellent gene delivery vehicles to target tumour environments. In a series of previous studies we demonstrated active homing of HSV-TK-transduced MSCs into pancreatic, breast and liver cancer tumour stroma that led to a significant reduction in tumour growth and, depending on the targeting strategy used, reduced incidence of metastases after application of ganciclovir (Zischek et al. 2009, Conrad et al. 2011, Niess et al. 2011). In more recent studies, we have shown that MSCs transfected with NIS under control of the CMV promoter or the tumour stroma-specific RANTES/CCL5 promoter are actively recruited to experimental HCC as well as disseminated colon cancer liver metastases and induce anti-tumour effects after application of 131I or 188Re based on NIS-mediated radioiodine accumulation (Knoop et al. 2011, Knoop et al. 2013). However, full therapeutic potential can only be exploited when MSCs are efficiently recruited to their site of action. Several approaches have been used to increase MSC survival, migration and differentiation, including the application of growth factors and overexpression of stem cell regulatory genes (Chen et al. 2013). In agreement with our in vitro data, we observed a significant impact of thyroid hormone status on MSC recruitment and invasion in an αvβ3-negative HCC xenograft mouse model. In hyperthyroid animals, both the recruitment of MSCs and their subsequent invasion into tumours was markedly enhanced in comparison with euthyroid and in particular hypothyroid mice that showed low levels of MSC recruitment and almost no invasion. These data suggest that MSC conditioning with T3 or T4 and/or T3 or T4 treatment of patients could serve as an effective tool to enhance MSC migration and engraftment in tissue-engineering and gene-delivery approaches.

At the same time, it should be taken into account that the stimulatory effect of iodothyronines, shown in our study, on the differentiation of MSCs towards CAFs that are known to support a microenvironment that drives tumour progression and metastasis, could enhance tumour growth (Franco et al. 2010). However, depending on the approach used, MSC-based cancer gene therapy can include the destruction of exogenously applied engineered MSCs in the context of therapy, which is likely to overcome any endogenous tumour-promoting effects of adoptively applied MSCs. This was demonstrated in our previous work using MSCs as delivery vehicles for tumour-selective NIS gene delivery, showing no tumour growth-promoting effects in subcutaneous HuH7 or hepatic colon cancer metastasis xenograft mouse models where a significant therapeutic effect of 131I or 188Re was seen (Knoop et al. 2011, Knoop et al. 2013). Moreover, we did not observe an effect of thyroid hormone status or tetrac treatment on the growth of the HCC xenograft model used in this study, which we attribute to the absence of integrin αvβ3 on HuH7 cells and also to the short time frame for the assessment of tumour stroma-mediated effects on tumour growth in our experimental setting.

Further, we observed a dramatic effect of tetrac treatment in euthyroid mice that led to a nearly complete abolishment of MSC recruitment into the tumour. Tetrac also reversed effects of T3 and T4 on CAF marker gene expression, migration and invasion in vitro. While tetrac is known to exert low-grade thyromimetic effects intracellularly (Moreno et al. 2008), it was shown to have anti-tumour effects in vitro and in vivo in various cancer models via modulation of tumour cell proliferation, apoptosis and angiogenesis by T3/T4 antagonistic action mediated through integrin αvβ3 (Yalcin et al. 2009, Davis et al. 2011). Further anti-tumour activity of tetrac includes the suppression of invasiveness/metastasis, increased radio- and chemosensitisation and antagonism of inflammation (Davis et al. 2011, Hercbergs et al. 2012, Yalcin et al. 2013, Davis et al. 2014). These effects are thought to be largely mediated by αvβ3 expressed on the tumour cells themselves. Using an αvβ3-negative tumour model, our data suggest a novel mechanism by which tetrac can exert anti-tumoural effects, not by targeting the cancer cells per se, but by targeting the tumour stroma via MSCs as important stomal progenitor cells. Besides presenting an additional aspect of tetrac's anti-tumour action, this effect opens the prospect of using tetrac as therapy agent irrespective of integrin αvβ3 expression on tumour cells.

In conclusion, our data suggest that thyroid hormones T3 and T4 have a profound effect on the biology of MSCs in the tumour microenvironment through stimulation of CAF-like differentiation as well as migration and invasion in vitro. Tetrac-dependency demonstrates that these effects are largely mediated through non-genomic mechanisms via integrin αvβ3. In vivo, the thyroid status had a dramatic impact on MSC recruitment and tumour invasion with increased recruitment in the hyperthyroid state that was significantly decreased in the hypothyroid state and almost abolished upon treatment with tetrac. These studies enhance our understanding of the critical role of T3 and T4 in the regulation of MSC differentiation and migration in the context of tumour stroma formation and stroma-targeted cancer therapy, as well as the molecular mechanisms of the anti-tumour activity of tetrac.

Supplementary data

This is linked to the online version of the paper at http://dx.doi.org/10.1530/ERC-15-0245.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from the Deutsche Forschungsgemeinschaft within the Priority Programme SPP1629 to C Spitzweg, P J Nelson (SP 581/6-1, SP581/6-2, NE 648/5-2) and H Heuer (HE 3418/7-1), as well as within the Collaborative Research Center (SFB 824, project C 08) to C Spitzweg.

Acknowledgements

The laboratory work was conducted at the Departments of Internal Medicine II and IV, University Hospital of Munich, Munich, Germany. We are grateful to Roswitha Beck and Rosel Oos (Department of Nuclear Medicine, University Hospital of Munich, Germany) for their assistance with animal care and Josef Köhrle (Institut für Experimentelle Endokrinologie, Charité-Universitätsmedizin Berlin, Germany) for thyroid hormone measurements in mouse serum within the Priority Programme SPP1629 (Deutsche Forschungsgemeinschaft).

References

  • Balzan S, Del Carratore R, Nardulli C, Sabatino L, Lubrano V & Iervasi G 2013 The stimulative effect of T3 and T4 on human myocardial endothelial cell proliferation, migration and angiogenesis. Journal of Clinical & Experimental Cardiology 04 17. (doi:10.4172.2125-9880.1000280).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Barcellos-de-Souza P, Gori V, Bambi F & Chiarugi P 2013 Tumor microenvironment: bone marrow-mesenchymal stem cells as key players. Biochimica et Biophysica Acta 1836 321335. (doi:10.1016/j.bbca.2013.10.004).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bergh JJ, Lin HY, Lansing L, Mohamed SN, Davis FB, Mousa S & Davis PJ 2005 Integrin αvβ3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology 146 28642871. (doi:10.1210/en.2005-0102).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bolte S & Cordelieres FP 2006 A guided tour into subcellular colocalization analysis in light microscopy. Journal of Microscopy 224 213232. (doi:10.1111/j.1365-2818.2006.01706.x).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cayrol F, Diaz Flaque MC, Fernando T, Yang SN, Sterle HA, Bolontrade M, Amoros M, Isse B, Farias RN & Ahn H et al. 2015 Integrin αvβ3 acting as membrane receptor for thyroid hormones mediates angiogenesis in malignant T cells. Blood 125 841851. (doi:10.1182/blood-2014-07-587337).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Chen J, Crawford R, Chen C & Xiao Y 2013 The key regulatory roles of the PI3K/Akt signaling pathway in the functionalities of mesenchymal stem cells and applications in tissue regeneration. Tissue Engineering. Part B, Reviews 19 516528. (doi:10.1089/ten.teb.2012.0672).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cohen K, Flint N, Shalev S, Erez D, Baharal T, Davis PJ, Hercbergs A, Ellis M & Ashur-Fabian O 2014 Thyroid hormone regulates adhesion, migration and matrix metalloproteinase 9 activity via αvβ3 integrin in myeloma cells. Oncotarget 5 63126322.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conrad C, Gupta R, Mohan H, Niess H, Bruns CJ, Kopp R, von Luettichau I, Guba M, Heeschen C & Jauch KW et al. 2007 Genetically engineered stem cells for therapeutic gene delivery. Current Gene Therapy 7 249260. (doi:10.2174/156652307781369119).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conrad C, Husemann Y, Niess H, von Luettichau I, Huss R, Bauer C, Jauch KW, Klein CA, Bruns C & Nelson PJ 2011 Linking transgene expression of engineered mesenchymal stem cells and angiopoietin-1-induced differentiation to target cancer angiogenesis. Annals of Surgery 253 566571. (doi:10.1097/SLA.0b013e3181fcb5d8).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Davis PJ, Davis FB, Lin HY, Mousa SA, Zhou M & Luidens MK 2009 Translational implications of nongenomic actions of thyroid hormone initiated at its integrin receptor. American Journal of Physiology. Endocrinology and Metabolism 297 E1238E1246. (doi:10.1152/ajpendo.00480.2009).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Davis PJ, Davis FB, Mousa SA, Luidens MK & Lin HY 2011 Membrane receptor for thyroid hormone: physiologic and pharmacologic implications. Annual Review of Pharmacology and Toxicology 51 99115. (doi:10.1146/annurev-pharmtox-010510-100512).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Davis PJ, Lin HY, Sudha T, Yalcin M, Tang HY, Hercbergs A, Leith JT, Luidens MK, Ashur-Fabian O & Incerpi S et al. 2014 Nanotetrac targets integrin αvβ3 on tumor cells to disorder cell defense pathways and block angiogenesis. OncoTargets and Therapy 7 16191624. (doi:10.2147/OTT.S67393).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dembinski JL, Wilson SM, Spaeth EL, Studeny M, Zompetta C, Samudio I, Roby K, Andreeff M & Marini FC 2013 Tumor stroma engraftment of gene-modified mesenchymal stem cells as anti-tumor therapy against ovarian cancer. Cytotherapy 15 2032. (doi:10.1016/j.jcyt.2012.10.003).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • De Vito P, Balducci V, Leone S, Percario Z, Mangino G, Davis PJ, Davis FB, Affabris E, Luly P & Pedersen JZ et al. 2012 Nongenomic effects of thyroid hormones on the immune system cells: new targets, old players. Steroids 77 988995. (doi:10.1016/j.steroids.2012.02.018).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D & Horwitz E 2006 Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8 315317. (doi:10.1080/14653240600855905).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dvorak HF 1986 Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. New England Journal of Medicine 315 16501659. (doi:10.1056/NEJM198612253152606).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dwyer RM & Kerin MJ 2010 Mesenchymal stem cells and cancer: tumor-specific delivery vehicles or therapeutic targets? Human Gene Therapy 21 15061512. (doi:10.1089/hum.2010.135).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dwyer RM, Khan S, Barry FP, O'Brien T & Kerin MJ 2010 Advances in mesenchymal stem cell-mediated gene therapy for cancer. Stem Cell Research & Therapy 1 25. (doi:10.1186/scrt25).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dwyer RM, Ryan J, Havelin RJ, Morris JC, Miller BW, Liu Z, Flavin R, O'Flatharta C, Foley MJ & Barrett HH et al. 2011 Mesenchymal stem cell-mediated delivery of the sodium iodide symporter supports radionuclide imaging and treatment of breast cancer. Stem Cells 29 11491157. (doi:10.1002/stem.665).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Edelstein A, Amodaj N, Hoover K, Vale R & Stuurman N 2010 Computer control of microscopes using microManager. Current Protocols in Molecular Biology 92 Unit 14.20 14.20.1–14.20.17 doi:10.1002/0471142727.mb1420s92).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Franco OE, Shaw AK, Strand DW & Hayward SW 2010 Cancer associated fibroblasts in cancer pathogenesis. Seminars in Cell & Developmental Biology 21 3339. (doi:10.1016/j.semcdb.2009.10.010).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Groba C, Mayerl S, van Mullem AA, Visser TJ, Darras VM, Habenicht AJ & Heuer H 2013 Hypothyroidism compromises hypothalamic leptin signaling in mice. Molecular Endocrinology 27 586597. (doi:10.1210/me.2012-1311).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gualda E, Moreno N, Tomancak P & Martins GG 2014 Going "open" with mesoscopy: a new dimension on multi-view imaging. Protoplasma 251 363372. (doi:10.1007/s00709-013-0599-3).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hercbergs AH, Davis FB, Lin H-Y, Luidens MK, Meng R, Ashur-Fabian O, Mousa SA & Davis PJ 2012 Integrin-mediated actions of thyroid hormone analogues on tumor cell chemosensitivity, integrin-growth factor receptor crosstalk and inflammatory gene expression. Cancer and Clinical Oncology 1 3240. (doi:10.5539/cco.v1n1p32).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Hercbergs A, Johnson RE, Ashur-Fabian O, Garfield DH & Davis PJ 2015 Medically induced euthyroid hypothyroxinemia may extend survival in compassionate need cancer patients: an observational study. Oncologist 20 7276. (doi:10.1634/theoncologist.2014-0308).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Huisken J, Swoger J, Del Bene F, Wittbrodt J & Stelzer EH 2004 Optical sectioning deep inside live embryos by selective plane illumination microscopy. Science 305 10071009. (doi:10.1126/science.1100035).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Jin ZH, Furukawa T, Claron M, Boturyn D, Coll JL, Fukumura T, Fujibayashi Y, Dumy P & Saga T 2012 Positron emission tomography imaging of tumor angiogenesis and monitoring of antiangiogenic efficacy using the novel tetrameric peptide probe 64Cu-cyclam-RAFT-c(-RGDfK-)4. Angiogenesis 15 569580. (doi:10.1007/s10456-012-9281-1).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kholodenko IV, Konieva AA, Kholodenko RV & Yarygin KN 2013 Molecular mechanisms of migration and homing of intravenously transplanted mesenchymal stem cells. Journal of Tissue Engineering and Regenerative Medicine 2 2. (doi:10.7243/2050-1218-2-4).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kidd S, Spaeth E, Watson K, Burks J, Lu H, Klopp A, Andreeff M & Marini FC 2012 Origins of the tumor microenvironment: quantitative assessment of adipose-derived and bone marrow-derived stroma. PLoS ONE 7 e30563. (doi:10.1371/journal.pone.0030563).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Klopp AH, Spaeth EL, Dembinski JL, Woodward WA, Munshi A, Meyn RE, Cox JD, Andreeff M & Marini FC 2007 Tumor irradiation increases the recruitment of circulating mesenchymal stem cells into the tumor microenvironment. Cancer Research 67 1168711695. (doi:10.1158/0008-5472.CAN-07-1406).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Knoop K, Kolokythas M, Klutz K, Willhauck MJ, Wunderlich N, Draganovici D, Zach C, Gildehaus FJ, Boning G & Goke B et al. 2011 Image-guided, tumor stroma-targeted 131I therapy of hepatocellular cancer after systemic mesenchymal stem cell-mediated NIS gene delivery. Molecular Therapy 19 17041713. (doi:10.1038/mt.2011.93).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Knoop K, Schwenk N, Dolp P, Willhauck MJ, Zischek C, Zach C, Hacker M, Goke B, Wagner E & Nelson PJ et al. 2013 Stromal targeting of sodium iodide symporter using mesenchymal stem cells allows enhanced imaging and therapy of hepatocellular carcinoma. Human Gene Therapy 24 306316. (doi:10.1089/hum.2012.104).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Knoop K, Schwenk N, Schmohl K, Muller A, Zach C, Cyran C, Carlsen J, Boning G, Bartenstein P & Goke B et al. 2015 Mesenchymal stem cell-mediated, tumor stroma-targeted radioiodine therapy of metastatic colon cancer using the sodium iodide symporter as theranostic gene. Journal of Nuclear Medicine 56 600606. (doi:10.2967/jnumed.114.146662).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Luidens MK, Mousa SA, Davis FB, Lin HY & Davis PJ 2010 Thyroid hormone and angiogenesis. Vascular Pharmacology 52 142145. (doi:10.1016/j.vph.2009.10.007).

  • Mishra PJ, Mishra PJ, Humeniuk R, Medina DJ, Alexe G, Mesirov JP, Ganesan S, Glod JW & Banerjee D 2008 Carcinoma-associated fibroblast-like differentiation of human mesenchymal stem cells. Cancer Research 68 43314339. (doi:10.1158/0008-5472.CAN-08-0943).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Moreno M, de Lange P, Lombardi A, Silvestri E, Lanni A & Goglia F 2008 Metabolic effects of thyroid hormone derivatives. Thyroid 18 239253. (doi:10.1089/thy.2007.0248).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Niess H, Bao Q, Conrad C, Zischek C, Notohamiprodjo M, Schwab F, Schwarz B, Huss R, Jauch KW, Nelson PJ & Bruns CJ 2011 Selective targeting of genetically engineered mesenchymal stem cells to tumor stroma microenvironments using tissue-specific suicide gene expression suppresses growth of hepatocellular carcinoma. Annals of Surgery 254 767774; discussion 774–775. (doi:10.1097/SLA.0b013e3182368c4f).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ollion J, Cochennec J, Loll F, Escude C & Boudier T 2013 TANGO: a generic tool for high-throughput 3D image analysis for studying nuclear organization. Bioinformatics 29 18401841. (doi:10.1093/bioinformatics/btt276).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pinto M, Soares P & Ribatti D 2011 Thyroid hormone as a regulator of tumor induced angiogenesis. Cancer Letters 301 119126. (doi:10.1016/j.canlet.2010.11.011).

  • Pitrone PG, Schindelin J, Stuyvenberg L, Preibisch S, Weber M, Eliceiri KW, Huisken J & Tomancak P 2013 OpenSPIM: an open-access light-sheet microscopy platform. Nature Methods 10 598599. (doi:10.1038/nmeth.2507).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ponte AL, Marais E, Gallay N, Langonne A, Delorme B, Herault O, Charbord P & Domenech J 2007 The in vitro migration capacity of human bone marrow mesenchymal stem cells: comparison of chemokine and growth factor chemotactic activities. Stem Cells 25 17371745. (doi:10.1634/stemcells.2007-0054).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Preibisch S, Saalfeld S, Schindelin J & Tomancak P 2010 Software for bead-based registration of selective plane illumination microscopy data. Nature Methods 7 418419. (doi:10.1038/nmeth0610-418).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rühland S, Wechselberger A, Spitzweg C, Huss R, Nelson PJ & Harz H 2015 Quantification of in vitro mesenchymal stem cell invasion into tumor spheroids using selective plane illumination microscopy. Journal of Biomedical Optics 20 040501. (doi:10.1117/1.JBO.20.4.040501).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schmohl KA, Müller AM, Schwenk N, Knoop K, Rijntjes E, Köhrle J, Heuer H, Bartenstein P, Göke B, Nelson PJ & Spitzweg C 2015 Establishment of an effective radioiodide thyroid ablation protocol in mice. European Thyroid Journal 4 (suppl 1) 7480. (doi:10.1159/000381019).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Spaeth E, Klopp A, Dembinski J, Andreeff M & Marini F 2008 Inflammation and tumor microenvironments: defining the migratory itinerary of mesenchymal stem cells. Gene Therapy 15 730738. (doi:10.1038/gt.2008.39).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Spaeth EL, Dembinski JL, Sasser AK, Watson K, Klopp A, Hall B, Andreeff M & Marini F 2009 Mesenchymal stem cell transition to tumor-associated fibroblasts contributes to fibrovascular network expansion and tumor progression. PLoS ONE 4 e4992. (doi:10.1371/journal.pone.0004992).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Uchibori R, Tsukahara T, Ohmine K & Ozawa K 2014 Cancer gene therapy using mesenchymal stem cells. International Journal of Hematology 99 377382. (doi:10.1007/s12185-014-1537-7).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yalcin M, Bharali DJ, Lansing L, Dyskin E, Mousa SS, Hercbergs A, Davis FB, Davis PJ & Mousa SA 2009 Tetraidothyroacetic acid (tetrac) and tetrac nanoparticles inhibit growth of human renal cell carcinoma xenografts. Anticancer Research 29 38253831.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yalcin M, Lin HY, Sudha T, Bharali DJ, Meng R, Tang HY, Davis FB, Stain SC, Davis PJ & Mousa SA 2013 Response of human pancreatic cancer cell xenografts to tetraiodothyroacetic acid nanoparticles. Hormones & Cancer 4 176185. (doi:10.1007/s12672-013-0137-y).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang X, Yao S, Liu C & Jiang Y 2015 Tumor tropic delivery of doxorubicin-polymer conjugates using mesenchymal stem cells for glioma therapy. Biomaterials 39 269281. (doi:10.1016/j.biomaterials.2014.11.003).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhu Y, Cheng M, Yang Z, Zeng CY, Chen J, Xie Y, Luo SW, Zhang KH, Zhou SF & Lu NH 2014 Mesenchymal stem cell-based NK4 gene therapy in nude mice bearing gastric cancer xenografts. Drug Design, Development and Therapy 8 24492462. (doi:10.2147/DDDT.S71466).

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zischek C, Niess H, Ischenko I, Conrad C, Huss R, Jauch KW, Nelson PJ & Bruns C 2009 Targeting tumor stroma using engineered mesenchymal stem cells reduces the growth of pancreatic carcinoma. Annals of Surgery 250 747753. (doi:10.1097/SLA.0b013e3181bd62d0).

    • PubMed
    • Search Google Scholar
    • Export Citation

Supplementary Materials

 

  • Collapse
  • Expand
  • Evaluation of integrin αvβ3 expression on HuH7 and MSCs. MSCs were treated with HuH7 CM alone or in the presence of 1 nM T3 or 1 μM T4 with or without 100 nM tetrac, or in the presence of tetrac alone for 24 h. HuH7 and MSCs were analysed for integrin αvβ3 expression by flow cytometry. A representative image from three experiments is shown.

  • Expression of CAF-like markers in MSCs is stimulated by thyroid hormones T3 and T4 via integrin αvβ3. MSCs were treated with HuH7 CM alone (grey line) or in the presence of 1 nM T3 or 1 μM T4 with or without 100 nM tetrac, or in the presence of tetrac alone for 24 h. Expression of CAF-like markers was assessed at the mRNA level by qPCR ((A) T3, (B) T4) and at the protein level by ELISA (C). Results are expressed as mean fold change compared to control cells treated with HuH7 CM only (n=4; two-tailed Student's t-test: *P<0.05; **P<0.01; ***P<0.001).

  • Migration of MSCs towards tumour cell CM is increased upon T3 and T4 treatment mediated by integrin αvβ3. (A) Representative trajectories of untreated MSCs without gradient influence. (B, C, D, E, F and G) Representative trajectories of MSCs treated with 1 nM T3 or 1 μM T4 with or without 100 nM tetrac or with tetrac alone for 24 h migrating along a linear gradient of HuH7 CM over 24 h compared to untreated control cells from six independent experiments. Centres of mass are indicated by red dots. (H, I) Quantification of chemotaxis parameters FMI and CoM (two-tailed Student's t-test: *P<0.05; **P<0.01).

  • Deeper invasion of MSCs into 3D HuH7 spheroids upon T3 and T4 treatment is reversed upon additional treatment with tetrac. (A, B, C, D and E) Representative images of CMFDA-labelled MSCs (green) treated with 1 nM T3 or 1 μM T4 with or without 100 nM tetrac for 24 h invading into HuH7 spheroids (blue). (F) Quantification of invasion depths in distance from surface of the spheroid (n=3; Kruskal–Wallis test: **P<0.01). Cell clusters are indicated by asterisks.

  • Thyroid hormone status significantly influences MSC recruitment into tumours in vivo. In a HuH7 tumour xenograft model, mice were injected daily with 20 ng/g body weight l-T4 (euthyroid; n=7), 100 ng/g body weight l-T4 (hyperthyroid; n=8), saline (hypothyroid; n=8) or 20 ng/g body weight l-T4+10 μg/g body weight tetrac (euthyroid+tetrac; n=8). 72 h before sacrifice, 5×105 CMFDA-labelled MSCs were injected i.v. Frozen tumour sections were counterstained with Hoechst dye and imaged by fluorescence microscopy. (A) One representative image is shown per group. Magnification: 10×, scale bar=100 μm. (B) Quantification of MSC recruitment to tumours depicted as mean values of CMFDA positive area in % for each group (two-tailed Student's t-test: ***P<0.001).