Abstract
We previously proposed that high expression of FAM129A can be used as a thyroid carcinoma biomarker in preoperative diagnostic exams of thyroid nodules. Here, we identify that FAM129A expression is increased under nutrient and growth factor depletion in a normal thyroid cell line (PCCL3), overlapping with increased expression of autophagy-related protein and inhibition of AKT/mTOR/p70S6K. Supplementation of insulin, TSH and serum to the medium was able to reduce the expression of both FAM129A and autophagy-related protein and reestablish the AKT/mTOR/p70S6K axis. To determine the direct role of FAM129A on autophagy, FAM129A was transfected into PCCL3 cells. Its overexpression induced autophagic vesicles formation, evidenced by transmission electron microscopy. Co-expression of FAM129A and mCherry-EGFP-LC3B in PCCL3 showed an increased yellow puncta formation, suggesting that FAM129Ainduces autophagy. To further confirm its role on autophagy, we knockdown FAM129A in two thyroid carcinoma cell lines (TPC1 and FTC-236). Unexpectedly, FAM129A silencing increased autophagic flux, suggesting that FAM129A inhibits autophagy in these models. We next co-transfected PCCL3 cells with FAM129A and RET/PTC1 and tested autophagy in this context. Co-expression of FAM129A and RET/PTC1 oncogene in PCCL3 cells, inhibited RET/PTC1-induced autophagy. Together, our data suggest that, in normal cells FAM129A induces autophagy in order to maintain cell homeostasis and provide substrates under starvation conditions. Instead, in cancer cells, decreased autophagy may help the cells to overcome cell death. FAM129A regulates autophagy in a cell- and/or context-dependent manner. Our data reinforce the concept that autophagy can be used as a strategy for cancer treatment.
Introduction
Thyroid cancer incidence has been increasing over the last three decades worldwide (Howlader et al. 2015, La Vecchia et al. 2015). As thyroid cancer typically presents as a thyroid nodule, proper diagnosis is required for management decision. The gold standard method for the differential diagnosis of a thyroid nodule is the fine-needle aspiration cytology (FNAC). However, nearly 30% of FNACs yield an indeterminate result, which comprises Bethesda III–V categories. Although the risk of malignancy varies from 10 to 75%, depending on the Bethesda classification, most of the patients undergo surgery for a definitive diagnosis (Haugen et al. 2016, Liu et al. 2016).
In an effort to reduce unnecessary surgeries, we previously searched for molecular markers that could help to refine the preoperative diagnosis of indeterminate thyroid nodules. We developed a predictive model, based on the expression of four carcinoma markers (FAM129A, ITM1, ARG2 and DDIT3), combined with the expression of a marker for Hürthle cell adenoma (PVALB). The antibody-based panel significantly improved the ability to distinguish benign from malignant thyroid nodules (Cerutti et al. 2004, 2006, 2011).
Among these markers, FAM129A (aliases C1orf24, NIBAN and GIG39) has been reported to be overexpressed in various human cancer, strengthening its pathogenic relevance (Majima et al. 2000, Adachi et al. 2004, Matsumoto et al. 2006, Ito et al. 2009, Thomas et al. 2016). FAM129A (family with sequence similarity 129 member A) gene is mapped on chromosome 1q25.3 and codifies a protein predominantly expressed in the cytoplasm. The encoded protein may play a role in regulating cell death.
FAM129A was initially identified as differentially expressed in Tsc2 mutant rats, a model of hereditary renal carcinoma (Majima et al. 2000). The absence of expression in normal rat/human kidneys, associated with its overexpression in other renal carcinogenesis model, sporadic human renal carcinomas and renal carcinoma cell lines, supported their hypothesis that FAM129A is a marker of renal carcinogenesis. The authors suggested that FAM129A function as a protector against cell death under stress conditions (Adachi et al. 2004).
Others have showed that FAM129A is induced under endoplasmic reticulum (ER) stress in few cell types such as liver, kidney and cerebrum and may function to link and coordinate ER stress and mTOR/S6K1 pathway (Sun et al. 2007).
Moreover, it was demonstrated that ultraviolet irradiation induced FAM129A phosphorylation by AKT in human glioblastoma and lung cancer cells with subsequent proteasomal degradation of p53, suggesting that FAM129A protected cells from genotoxic stress-induced apoptosis (Ji et al. 2012).
Although it has been suggested that FAM129A is upregulated in response to different stress conditions to protect cells against cell death, its precise role in regulating cell survival and death and the mechanism by which FAM129A acts is not completely understood. Considering that autophagy is rapidly upregulated under cell stress, such as nutrient starvation, growth factor depletion, reactive oxygen species (ROS) accumulation and ER stress (Kroemer et al. 2010, Qin et al. 2010, Zhao & Goldberg 2016), as well as that FAM129A is induced by different stress conditions in different cell models, we here investigated the expression of FAM129A under nutrient starvation and explored its role on autophagy in thyroid carcinoma cell lines.
Materials and methods
Cell culture
The Nthy-ori 3–1 (human thyroid follicular epithelial derived from normal thyroid tissue), WRO and FTC-236 (human follicular thyroid carcinoma cell lines), TPC1 (human papillary thyroid carcinoma cell lines) and PCCL3 (differentiated rat normal thyroid cell line) were grown as described in Supplementary Table 1 (see section on supplementary data given at the end of this article).
Nutrient starvation and growth factor withdrawal
To investigate whether FAM129A expression is induced under stress conditions, both PCCL3 and FTC-236 cells were submitted to nutrient starvation and growth factor depletion, as previously described (Malaguarnera et al. 2014). Briefly, PCCL3 or FTC-236 cells, which require TSH and insulin to growth, were placed in culture medium without TSH for 48 h. The following day, the medium was changed to TSH, insulin and fetal bovine serum (FBS)-deprived medium for 24 h. After 24 h of incubation without TSH, insulin and FBS, the medium was aspirated and the cells were either treated with TSH (1 mU/mL), insulin (10 μg/mL), TSH combined with insulin or FBS for 20 min. After treatment, cells were collected to Western blot analysis. TPC1 cells were subjected to nutrient withdrawal by replacing growth medium for Earle’s Balanced Salt Solution (EBSS – Sigma-Aldrich) for 1 h. After treatment, cells were collected to Western blot analysis.
Western blot analysis
Cells were washed with ice-cold PBS, harvested on ice and lysed with ice-cold lysis buffer (50 mM Tris–HCl, 100 mM NaCl, 50 mM NaF, 1 mM NaVO4 and 0.5% Triton-X solution) supplemented with the protease inhibitor Cocktail tablets (Roche). Protein concentration was determined by BCA Protein Assay Kit (Pierce, Biotechnologies). About 30 µg of total protein were resolved in 8–12% SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad). The membranes were blocked for non-specific binding with 5% non-fat dried milk in 1× TBST buffer and incubated at 4°C for at least 16 h with the indicated antibodies, as follows: anti-FAM129A (1:200, generated in-house (Cerutti et al. 2004)), anti-LC3B (1:1000, Cell Signaling), anti-p-p70S6K (T389) (1:300, Cell Signaling), anti-p-AKT (S473) (1:1000, Cell Signaling), anti-p-ERK1/2 (T202/Y204) (1:1000, Cell Signaling), anti-V5-Tag (1:2000, Thermo Fisher Scientific), and anti-α-tubulin (1:10,000) (Sigma-Aldrich). Secondary antibodies conjugated with horseradish peroxidase anti-rabbit (1:10,000, Dako) or anti-mouse (1:10,000, Santa Cruz Biotechnology) were used. The membranes were incubated with Immobilon Western Chemiluminescent HRP Substrate (Merck). The chemiluminescent signal was detected by ImageQuant LAS 4000 system (GE Healthcare). The band intensities were quantified using the ImageJ software (NIH) and corrected for background differences. The data were normalized to the expression of α-tubulin (loading control) and expressed as fold-change.
Generation of plasmid constructs
The full-length cDNA of human FAM129A was synthetized from RNA isolated from a follicular carcinoma thyroid sample, which presented high levels of FAM129A expression, using SuperScript III (Life Technologies), according to manufacturer’s recommendations. An aliquot of the cDNA was used as template in a 50 μL PCR reaction. To insert HindIII and BamHI restriction sites at the 5′ and 3′-terminii of the PCR product, a sense primer containing HindIII (underlined) and an antisense primer with BamHI (underlined) were used to generate PCR products, as follows: sense: 5′ CCGAAGCTTCAGTTTCCGCGCTCAGCACAGG 3′ and antisense: 5′ CCGGGATCCCTCCTCTGAGGGCAGCTCTGGG 3′. The full-length cDNA of RET/PTC1 was synthetized from a RNA isolated from a RET/PTC1-positive sample (Bastos et al. 2015). An aliquot of the cDNA was used as template to PCR amplification. To insert KpnI sites (underlined) at the 5′ and 3′-terminii of the PCR product, a sense 5′ CCGGGTACCGCCGCGGCCATGGCGGACAGCGC 3′ and antisense 5′ CCGGGTACCGAATCTAGTAAATGCATGGGAAATTCT 3′ primers were used to generate PCR products. The amplified products were purified, digested with respective endonucleases and cloned into pBudCE4.1 vector (Invitrogen). Final constructs were sequenced using BigDye Terminator v3.1 kit (Applied Biosystems) and carried out on an ABI3130xl sequencer (Applied Biosystems) equipment.
PCCL3 cell line transfections
FAM129A construct or empty vector (pBudCE4.1) were transfected into PCCL3 cell line by electroporation. Briefly, about 5 × 106 cells were resuspended in electroporation buffer (PBS with 0.1 mM CaCl2, 0.1% glucose) and electroporated with 5 µg of each DNA construct at 150 V and 900 µF, using the Gene Pulser II Electroporation System (Bio-Rad). Pools were selected in complete medium supplemented with 300 μg/mL Zeocin (Gibco).
Monitoring autophagosomes formation by transmission electron microscopy in PCCL3 cells expressing FAM129A
PCCL3 cells with ectopic expression of FAM129A and control (empty vector) were fixed and stained as previously described (Mendes et al. 2016). Cells were fixed in Karnovisky buffer (4% paraformaldehyde and 2% glutaraldehyde in 0.05 M sodium cacodylate buffer, pH 7.2) (Sigma-Aldrich). Post-fixation was performed in 0.1% osmium tetroxide and 0.1 M cacodylate buffer for 2 h. Then, cells were dehydrated with a graded acetone series, infiltrated in Spurr’s resin (Electron Microscopy Sciences, 14300) overnight and stained with 2% uranyl acetate and lead citrate. Finally, Philips EM 208 transmission electron microscope (FEI Ltd, Eindhoven, The Netherlands) was used to visualize the autophagosomes.
Plasmid, retroviral production and infection in PCCL3 expressing FAM129A
Viral preparation was performed as previously described (Pereira et al. 2017). Briefly, about 15 µg of mCherry-eGFP-LC3B construct and 5 µg of the vesicular stomatitis virus G protein vector were co-transfected into the 293 gp/bsr cell line by electroporation. Retroviral particles in the supernatant were supplemented with polybrene (4 μg/mL), after 48 h of transfection and stored at −80°C. PCCL3 cells (5 × 105) with stable expression of FAM129A or control (empty vector) were seeded in 35 mm dishes and, the next day, infected with supernatant containing retroviral particles for 24 h. The plasmid encoding mCherry-eGFP-LC3B construct was kindly provided by Dr Mauro Piacentini (University of Rome Tor Vergata, Rome, Italy).
Autophagic flux by confocal microscopy in PCCL3 cells expressing FAM129A
PCCL3 cells with overexpression of FAM129A, infected with mCherry-eGFP-LC3B vector, were seeded in coverslips, fixed in 4% paraformaldehyde after 48 h, washed in PBS and mounted in Fluoromount Aqueous Mounting Medium (Sigma-Aldrich). Fluorescent signal was detected in Zeiss LSM 780 Confocal Microscopy (Carl Zeiss), equipped with EC Plan-Neofluar Objective Lens (40×/0.7 PH2) and AxioCam HRc (Carl Zeiss). Wave lengths filters of 488 and 595 nm were used to detect green and red signals, respectively. Puncta formation was determined in ImageJ software using Watershed Segmentation plug-in. Twenty-five random cells were analyzed for yellow and red puncta formation, indicating autophagosome and autolysosome formation, respectively.
Autophagic flux in thyroid cancer cells
To investigate whether FAM129A interferes with autophagic flux in thyroid cancer cell lines (TPC1 or FTC-236), the cells (3 × 105) were seeded in 35 mm dishes for retroviral infection, as described above. Subsequently, the cells were infected with supernatant containing retroviral particles and submitted to selection with puromycin for 48 h. Finally, cells expressing mCherry-eGFP-LC3B vector were transfected with pre-designed validated siRNA against the human FAM129A (siRNA ID 128925) or transfected with scramble siRNA (siRNA ID 4390846) (Ambion Inc.) as previously described (Carvalheira et al. 2015). Briefly, 100 nM of pre-designed siRNAs were transiently transfected into 2.5 × 106 cells in electroporation buffer, at 150 V and 900 µF, using the Gene Pulser II Electroporation System (Bio-Rad). Autophagic flux was determined by confocal microscopy, as described above. To monitor the effect of FAM129A knockdown on signaling pathways, cell lysates from silenced and control cells were obtained 72 h post transfection and analyzed by Western blot.
Co-expression of FAM129A and RET/PTC1 in PCCL3 cells
To better understand the role of FAM129A in regulating autophagy, we co-expressed FAM129A and RET/PTC1 in PCCL3 cells. Five micrograms of each DNA construct were transiently transfected alone or in combination as described above. Total protein was isolated 72 h of transfection and analyzed by Western blot. The band intensities were quantified using the ImageJ software (NIH) and corrected for background differences. The data were normalized to the expression α-tubulin (loading control) and to the expression of V5 tag, which indicates RET/PTC1 expression.
Statistics
Quantitative data were submitted to Shapiro–Wilk Normality Test and Levene’s Test to assess the equality of variances. The data that met the parametric assumptions were submitted to Student’s t test or one-way ANOVA. As nonparametric test, Mann–Whitney or Kruskal–Wallis (followed by Dunn’s posttest) were used. P < 0.05 were considered statistically significant. Tests were performed in Stata12 (StataCorp LLC) and GraphPad Prism (GraphPad Software).
Results
Expression of FAM129A in thyroid cell lines
To define whether FAM129A is induced under stress conditions and its direct effects on expression of autophagy markers, we initially tested the endogen expression of FAM129A in two normal follicular thyroid (Nthy-ori 3–1 and PCCl3) and three thyroid carcinoma cell lines (WRO, FTC-236 and TPC1) by Western blot analysis. As both the normal thyroid rat cell line (PCCL3) and the thyroid carcinoma cell line (FTC-236) are maintained in medium containing TSH and insulin, they were selected to test the effects of nutrient deprivation and growth factors withdrawal (TSH, Insulin) in the expression of both FAM129A and autophagy-related protein.
The TPC1 and FTC-236 cell lines were used to investigate the effects of FAM129A knockdown on autophagy (Supplementary Fig. 1).
Metabolic stress-induced FAM129A and autophagy-related protein in PCCL3 cell line
To determine whether FAM129A expression is induced under nutrient starvation or growth factor depletion, PCCL3 cell line were maintained in medium without TSH, insulin and serum. FAM129A expression was induced at very high levels in PCCL3 cells maintained in reduced medium, compared to the cells in complete medium (P < 0.01) (Fig. 1A). Notably, in the normal thyroid rat cell line, a small size of FAM129A protein (70 kDa) was upregulated under stress conditions. This smaller band was observed only in rat cell line, which is similar to data reported previously (Adachi et al. 2004).
Western blot analysis of normal thyroid PC CL3 cells cultured under growth factors depleted medium and following insulin and TSH (alone or combination) or FBS replacement. (A) Expression of FAM129A and LC3-I/II. (B) Activity of main regulators of autophagy AKT/mTOR and MAPK/ERK, measured by p-p70S6K (T389), p-AKT (S473) and p-ERK (T202/T204) phosphorylation. The graphics show the densitometry analysis of each protein normalized by α-Tubulin. Data expressed as mean ± s.d. All experiments were performed in triplicate. *P < 0.05, **P < 0.01.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
Upon a 72 h of growth factors depletion, followed by replacement of insulin and TSH (alone or in combination) or FBS for 20 min, FAM129A expression was reduced (Fig. 1A). Interestingly, FAM129A expression was restored, at basal levels, when FBS was re-introduced (P < 0.01, Fig. 1A).
As autophagy process is activated as an adaptive response to different forms of metabolic stress, we next assessed the level of LC3-I (16 kDa) and LC3-II (14 kDa) protein expression, which is considered to be one of the most reliable markers of the autophagy process. As the ratio of LC3-II/α-tubulin is considered an accurate index of autophagy, relative levels of LC3-II protein were assessed. Although basal level of autophagy was detected in PCCL3 cells, higher ratio of LC3-II/α-tubulin was observed in PCCL3 cells under metabolic stress (Fig. 1A). The ratio of LC3-II/α-tubulin was restored to baseline (P < 0.05) when insulin (alone or in combination with TSH) were added to the medium. Even though FAM129A expression was restored when serum was replaced, the level of LC3-II was not reestablished to baseline levels when serum was replenished. These data suggest that the effect of serum replacement on expression of LC3-II in PCCL3 cells might be time dependent.
Altogether, these data indicated that elevated expression of FAM129A, under stress condition, can trigger autophagy.
Metabolic stress inhibited AKT/mTOR/p70S6K and activated ERK1/2 signaling pathways in PCCL3 cell line
As autophagy integrates multiples stress-sensitive signaling pathways, we investigated key signaling pathways that have been associated with autophagic process in response to nutrient and growth factors depletion such as AKT/mTOR/p70S6K and ERK1/2 signaling pathways. Nutrient and growth factors depletion inhibited AKT/p70S6K signaling pathway, while activated the ERK1/2 signaling pathway (Fig. 1B).
Insulin (alone or in combination) or serum restored the phosphorylation levels of AKT (S473), while the treatment with TSH alone did not decrease AKT phosphorylation. Upon treatment with insulin, TSH and serum, the p70S6K phosphorylation at T389 was restored at basal levels, while the treatment with insulin and TSH (in combination) increased the p70S6K phosphorylation at T389. These data suggest that TSH-induced phosphorylation of mTOR substrate p70S6K may not require AKT. ERK phosphorylation at T202 and T204 was partially inhibited by stimulation with TSH alone. When cells were stimulated with insulin (alone or in combination) or the serum was replaced into the medium, ERK phosphorylation was further reduced (Fig. 1B).
In summary, these data suggest that metabolic stress, which we found associated with increased expression of FAM129A and autophagy-related proteins in PCCL3 cells, inhibited AKT/mTOR/p70S6K while activated the ERK signaling pathway. Whether another pathway is involved in TSH-induced p70S6K activation and thus modulates autophagy, it is not clear.
FAM129A overexpression induces autophagy in PCCL3 cell line
In order to validate the direct effect of FAM129A expression on autophagy, the cDNA of FAM129A was cloned in pBudCE4.1 expression vector, under CMV promoter and transfected into PCCL3 cells. Autophagic process was monitored in FAM129A overexpressing cells and control using transmission electron microscopy (TEM). Although few autophagic vesicles were found by TEM within control cells, they were abundant through the cytoplasm within cytoplasm of FAM129A-expressing cells (Fig. 2A). These results suggested a direct effect of FAM129A on autophagy.
(A) Transmission electron microscopy of normal thyroid PCCL3 cells, transfected with empty vector (pBudCE4.1) or overexpressing FAM129A. Black arrowheads show autophagic vacuoles, characterized by double membrane vesicles. The number of autophagic vacuoles significantly increased in FAM129A-expressing cells. (B) Normal thyroid PCCL3 cells, transfected with empty pBudCE4.1 vector or containing cDNA of FAM129A, expressing mCherry-eGFP-LC3B autophagy marker. Autophagosomes are identified by yellow puncta in the cytoplasm while autolysosomes are visible as red puncta. Below, mean ± s.d. of puncta count per cell, of at least 25 cells. Experiments were performed in triplicate. ***P < 0.001.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
To confirm these results, autophagic flux was determined by transfecting FAM129A expressing cells and control with a mCherry-eGFP-LC3B vector. The double-tagged LC3B strategy, to distinguish autophagosomes from autolysosomes, has been largely used to monitor autophagic flux (Klionsky et al. 2016). When autophagy is induced, LC3B is lapidated to autophagosome membrane creating yellow puncta in the cytoplasm, as a result of mCherry and eGFP overlapping signals. As autophagy progresses, autophagosomes fuse with lysosomes generating autolysosomes and eGFP is degraded resulting in red puncta signal in the cytoplasm. We showed that FAM129A overexpression increased yellow puncta formation, suggesting that FAM129A induces autophagosome formation (Fig. 2B).
These results provided further evidence that FAM129A overexpression in associated with autophagy in PCCL3 cells.
FAM129A has opposed effect on autophagy in cancer cells
As FAM129A induced autophagy in normal thyroid cells, we next used siRNA strategy to knockdown FAM129A and confirm whether its silencing would reduce autophagy rate. The papillary thyroid carcinoma cell line (TPC1) and the follicular thyroid carcinoma cell line (FTC-236) were used as models.
The TPC1 and FTC-236 cells transfected with mCherry-eGFP-LC3B and subsequently transfected with FAM129A-specific siRNA were imaged and red and yellow puncta quantified (Fig. 3). The FAM129A knockdown efficiency in TPC1 and FTC-236 cells was confirmed by Western blot analysis (Fig. 4 and Supplementary Fig. 2). FAM129A silencing in both cancer cell lines resulted in a marked increase number of yellow (autophagosome) and red puncta (autolysosome) when compared to scramble siRNA (control group) (Fig. 3). These findings suggested that FAM129A inhibits autophagy in both cancer cell lines.
(A) Thyroid papillary carcinoma (TPC1) and (B) follicular thyroid carcinoma (FTC-236) cells expressing mCherry-eGFP-LC3B autophagy marker whereby FAM129A was silenced using siRNA (siFAM129A) and control cells (scramble). Autophagosomes are identified by yellow puncta in the cytoplasm while autolysosomes are visible as red puncta. Below, mean ± s.d. of puncta count per cell, of at least 25 cells. Experiments were performed in triplicate. **P < 0.01, ***P < 0.001.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
Western blot analysis of thyroid papillary carcinoma (TPC1) cells through which FAM129A was silenced and controls cells, cultured under starvation for 0 and 1 h. (A) Expression of FAM129A and autophagy-related protein LC3-I/II. (B) Activity of main regulators of autophagy AKT/mTOR and MAPK/ERK, measured by p-p70S6K (T389), p-AKT (S473) and p-ERK (T202/T204). The graphics represent the densitometry analysis of each protein normalized by α-Tubulin. Data expressed as mean ± s.d. All experiments were performed in triplicate. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
As FAM129A showed inhibitory effect on autophagy in thyroid cancer cells, we transfected TPC1 cells with siRNA to knockdown FAM129A and cultured the cells in nutrient depleted medium. When TPC1 cells were transfected with scramble siRNA (control) and autophagy was induced by amino acid starvation, FAM129A expression was induced (Fig. 4A). Additionally, FAM129A knockdown slightly increased the LC3-II expression. A much higher effect on LC3-II expression was observed when TPC1 transfected with siRNA to knockdown FAM129A were culture under stress conditions. These findings confirmed that FAM129A inhibited autophagy in TPC1 cancer cells.
Nutrient-sensitive pathways were also modulated by FAM129A silencing. Upon starvation, the phosphorylation of the mTOR substrate p70S6K was reduced in TPC1. Interestingly, FAM129A knockdown in TPC1 cells reduced the p70S6K (T389) and AKT (S473) phosphorylation, suggesting that both FAM129A and metabolic stress regulates phosphorylation of p70S6K and AKT. Metabolic stress in TPC1 cells increased ERK phosphorylation at T202 and T204, no additional effect was observed following FAM129A silencing (Fig. 4B).
Once FTC-236 cell line requires TSH and insulin to grow, cells were cultured in serum and growth factor-free medium. Under nutrient and growth factor depletion, FAM129A expression was significantly increased. When medium was replenished and insulin or serum was added to the media, FAM129A expression was decreased. However, FAM129A expression level was significantly reduced when cells were culture in insulin and TSH-supplemented medium, which was accompanied by higher expression of LC3-II (Fig. 5A), corroborating the data that FAM129A knockdown in FTC-236 cells induced autophagy.
Western blot analysis of Follicular Thyroid Carcinoma FTC-236 cells cultured under growth factors depleted medium and following insulin and TSH (alone or combination) or FBS replacement. (A) Expression of FAM129A and LC3-I/II. (B) Activity of main regulators of autophagy AKT/mTOR and MAPK/ERK, measured by p-p70S6K (T389), p-AKT (S473) and p-ERK (T202/T204). The graphics show the densitometry analysis of each protein normalized by α-Tubulin. Data expressed as mean ± s.d. All experiments were performed in triplicate. *P < 0.05, **P < 0.01 and ***P < 0.001.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
However, phosphorylation of p70S6K and AKT was not affected by metabolic stress or even when cells were maintained in medium supplemented with insulin, TSH (alone or combination) or serum (Fig. 5B).
Altogether these data suggest that FAM129A may modulate autophagy in a PI3K/AKT-dependent and -independent manner.
FAM129A dual effect on autophagy is context dependent
As FAM129A induced autophagy in PCCL3 cells, while its expression in thyroid carcinoma cell lines was associated with inhibition of autophagic process, we postulated that the effect of FAM129A on autophagy of thyroid cells is context dependent.
As TPC1 cell line is a papillary-derived cell line with RET/PTC1 fusion as a driver, we next transiently transfected RET/PTC1- and FAM129A-expressing vectors into PCCL3 (alone or in combination) and tested whether RET/PTC1 would interfere with autophagic process previously observed in PCCL3 expressing FAM129A.
As expected, the LC3-II expression was significantly higher in PCCL3 expressing FAM129A than that observed in control cells. Interestingly, ectopic expression of RET/PTC1 further increased LC3-II expression, while the expression of LC3-II was significantly lower in PCCL3 cells co-transfected with FAM129A and RET/PTC1, compared to controls (Fig. 6).
Western blot analysis of PCCL3 cells transfected with FAM129A or RET/PTC1 (alone or in combination) and control (empty vector). FAM129A, V5 tag (RET/PTC1) and LC3-I/II were evaluated. **P < 0.01.
Citation: Endocrine-Related Cancer 26, 1; 10.1530/ERC-17-0530
These results indicated that FAM129A might inhibit autophagy in a RET/PTC1-driven tumor (Fig. 6).
Discussion
In this study, we observed that in normal thyroid rat cell line PCCL3, nutrient and growth factors depletion induced both FAM129A and autophagy-related protein, while inhibits AKT/mTOR/p70S6K signaling pathway. The baseline autophagy was increased to supply limited nutrients and sustain cell survival. In response to nutrient and growth factor availability, FAM129A expression reduced while the AKT/p70S6K axis was activated leading to suppression of autophagy. Notably, the phosphorylation of ERK was significantly increased by nutrient and growth factor withdrawal. Its phosphorylation level was significantly reduced when cells were cultured in insulin, TSH and serum-supplemented medium.
Although it is not clear whether there is a crosstalk between PI3K/AKT/mTOR/p70S6K and MAPK/ERK pathway to regulate autophagy, it has been suggested that RAS protein might be involved in the intersection of MAPK/ERK and PI3K/AKT signaling pathways. RAS stimulates autophagy when the MAPK signaling pathway is activated, while inhibits autophagy when PI3K/AKT is activated (Furuta et al. 2004, Morani et al. 2014, Netea-Maier et al. 2015, Weckman et al. 2015). Whether an alternative pathway, involved in the TSH-induced activation of p70S6K in normal cells, may play a role in autophagy induction in thyroid cells, need further investigation.
To more directly investigate the role of FAM129A on autophagy, both the presence of autophagic vesicles and the autophagic flux were evaluated in PCCL3 cells. Autophagic events, such as autophagosomes and autolysosome, became detectable in normal thyroid cells with stable expression of FAM129A.
We further assessed the effects of FAM129A on autophagy in thyroid carcinoma cell lines TPC1 and FTC-236. Surprisingly, FAM129A knockdown inhibited autophagy and reduced the phosphorylation of AKT and p70S6K in TPC1 cells, suggesting that FAM129A induces autophagy in these cell lines through AKT/mTOR/p70S6K signaling pathway.
In FTC-236 cells, nutrient and growth factor withdrawal increased FAM129A expression. Although FAM129 expression was reduced and the expression of autophagy-related protein increased in insulin and TSH-supplemented media, the phosphorylation of AKT/p70S6K and ERK did not change. That is not surprising, as FTC-236 is a PTEN-null and TP53-mutated cell line, and it has been demonstrated that PTEN is necessary to suppress phosphorylation of AKT (He et al. 2012) and that P53 regulates autophagy via mTOR-dependent and independent pathway (Qu et al. 2003).
In summary, these data suggest that FAM129A likely inhibits autophagy via both AKT/mTOR/p70S6K-dependent and -independent pathway in thyroid cancer cells.
Based on FAM129A ability to induce autophagy in normal thyroid cell line and to inhibit autophagy in thyroid carcinoma cell lines, we hypothesized that FAM129A may play a dual role in the control of autophagy in thyroid cells and should be interpreted in these contexts.
As TPC1 cell lines harbor the RET/PTC1 oncogene, we co-expressed RET/PTC1 and FAM129A transcripts in PCCL3 normal thyroid cells and investigated the expression of autophagy-related protein. When RET/PTC1 and FAM129A were co-expressed in PCCL3 cells, LC3-II expression was significantly lower than the expression of RET/PTC1 alone. These findings suggested that, RET/PTC1 upregulated the baseline autophagy in PCCL3 cells, which was significantly repressed by FAM129A expression, suggesting that FAM129A inhibited autophagy induced by RET/PTC1 oncogene.
Similar to what we observed when RET/PTC1 oncogene was transfected into PCCL3 cells, others have also demonstrated that BRAF V600E and RAS mutations, which also constitutively activates MAPK/ERK pathway, upregulated autophagy in thyroid cancer cells (Morani et al. 2014).
These findings called into question why BRAF, RAS and RET/PTC1 transformed cells increase basal autophagy rate, together with the expression of FAM129A, which will ultimately reduce the expression of autophagy-related protein?
Oncogene-induced senescence (OIS) is a well-established event that occurs very early during tumorigenesis and is a critical step in tumor suppression. It was described in primary human thyrocyte transfected with BRAF V600E, HRAS and RET/PTC1 oncogenes and associated with growth arrest triggered by the enforced expression of cancer driver genes (Vizioli et al. 2011). An elegant study verified that autophagy was activated upon acute induction of OIS, in order to contribute to tumor suppression by controlling the senescence phenotype (Narita et al. 2009). Therefore, it would work as a pro-senescence mechanism. If tumor cells somehow bypass senescence, then autophagy might help the cells to survive under metabolic stress. It has been suggested that the level of autophagy might mediate diverse cellular responses.
We have previously shown that FAM129A knockdown induced cell cycle arrest (G0/G1), increased apoptosis and inhibited cell migration in the TPC1 cell line, suggesting that FAM129A increased cell survival via inhibition of apoptosis and induced cell migration (Carvalheira et al. 2015). We here showed that FAM129A knockdown, under stress conditions, inhibited autophagy in TPC1 cell line. Additionally, FAM129A inhibited autophagy in PCCL3 cells transfected with the oncogene RET/PTC1. Therefore, FAM129A might impact cell survival based on its ability to inhibit both apoptosis and autophagy.
Although FAM129A seems to play a role in autophagy, it is still unclear whether FAM129A is a candidate gene that sense lack of nutrients and/or growth factors in thyroid cells or is a downstream effector of signaling pathways that senses lack of nutrients and growth factors such as PI3K/AKT/mTOR and MAPK/ERK and promotes or inhibits depending on the cell context.
Importantly, the loss-of-function mutations in TSC1 and TSC2, key negative regulators of mTOR, lead to renal carcinogenesis in the hereditary renal cancer model. It is acknowledged that loss of TSC2 can result in abnormal activation of PI3K/AKT/mTOR pathway and ultimately autophagy inhibition (Ueno et al. 2008). FAM129A was initially identified as expressed in renal tumors developed in Tsc2-mutant rats (Eker) model (Majima et al. 2000). Later, the authors showed that FAM129A is strongly upregulated in the early stages of renal carcinogenesis and may function as a protector against cell death under stress conditions (Adachi et al. 2004).
Additionally, this group demonstrated that FAM129A is phosphorylated by AKT in response to genotoxic (ultraviolet irradiation) stress in human gliobastoma cells. In this cell tumor model, once phosphorylated at Ser602, FAM129A binds to nucleophosmin (NPM), thereby preventing NPM to bind to MDM2 oncoprotein, promoting P53 degradation and increasing cell survival (Ji et al. 2012).
Recently, FAM129A was identified as a novel target of ATF4, a key regulator of the adaptive integrated stress response (ISR). The authors showed that the level of FAM129A can confer a pro-survival function during ISR, through attenuation of the p53-dependent apoptotic responses (Evstafieva et al. 2018).
Several groups have showed that FAM129A is overexpressed in several cancer subtypes (Matsumoto et al. 2006, Ito et al. 2009, Thomas et al. 2016). Additionally, the human protein atlas analysis, which evaluated tissue array based on immunohistochemistry for numerous proteins in normal tissues and over 200 tumor subtypes from 20 different cancer and cell lines, demonstrated that FAM129A is overexpressed in colorectal cancer, breast cancer, prostate cancer, lung cancer, melanoma and other tumors, including thyroid (Uhlén et al. 2015). Although FAM129A is overexpressed in several tumors and might be overexpressed under different stress conditions, it might favor one pathway over another in a cell-, stress- and mutation type-dependent manner.
These finding suggests that, at least for some tumor types, pharmacological induction of autophagy might be advantageous in the early stages of tumorigenesis (Morani et al. 2014, Netea-Maier et al. 2015).
In conclusion, our results indicated that FAM129A may play a dual role in the regulation of autophagy in thyroid cells. It can increase baseline autophagy in normal thyroid cells in response to nutrient and growth factors depletion or can inhibit autophagy in thyroid carcinomas in the presence of activating mutations in oncogenes, such as RET/PTC1 fusion. It is still not clear whether, after passing the oncogene-induced replicative stress, autophagy might be induced to promote cell survival during tumor progression. Although our data suggest that FAM129A may regulate autophagy in thyroid cells through AKT/mTOR axis, it may also regulate autophagy through additional pathways. An improved understanding of this complex network will contribute to understand the role of FAM129A and autophagy in thyroid tumor progression. Finally, autophagy might be an alternative mechanism to treat different tumors.
Supplementary data
This is linked to the online version of the paper at https://doi.org/10.1530/ERC-17-0530.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The study was supported by grants from The São Paulo State Research Foundation (FAPESP) (2013/03867-5 and 2014/06570-6) and CNPq (470441/2013-5) to J M C. B H N, T B M and R P A are recipients of fellowship from FAPESP. J M C is a recipient of a scholarship of Research Productivity from CNPq.
Author contribution statement
B H N contributed with the design of the study, performed experiments, analyzed the data and wrote the manuscript. T B M performed experiments and analyzed the data. S S S and G J S P designed and interpreted the data produced the fluorescence microscopy in vitro model and analyzed the data. R P A helped with TEM assays. G G C designed, analyzed and interpreted the data. J M C conceived, designed and coordinated the study, analyzed and interpreted the data, edited and reviewed the final version of the manuscript. All authors reviewed and approved the final version of the manuscript.
Acknowledgements
The authors thank the Multiuser Multiphoton Confocal Microscopy Laboratory (INFAR-UNIFESP) and Prof. Ana Maria Cristina Rebello Pinto da Fonseca Martins for consenting us to use the confocal microscope.
References
Adachi H, Majima S, Kon S, Kobayashi T, Kajino K, Mitani H, Hirayama Y, Shiina H, Igawa M & Hino O 2004 Niban gene is commonly expressed in the renal tumors: a new candidate marker for renal carcinogenesis. Oncogene 23 3495–3500. (https://doi.org/10.1038/sj.onc.1207468)
Bastos AU, Oler G, Nozima BHN, Moysés RA & Cerutti JM 2015 BRAF V600E and decreased NIS and TPO expression are associated with aggressiveness of a subgroup of papillary thyroid microcarcinoma. European Journal of Endocrinology 173 525–540. (https://doi.org/10.1530/EJE-15-0254)
Carvalheira G, Nozima BH, Cerutti JM, Carvalheira G, Nozima BH & Cerutti JM 2015 MicroRNA-106b-mediated down-regulation of C1orf24 expression induces apoptosis and suppresses invasion of thyroid cancer. Oncotarget 6 28357–28370. (https://doi.org/10.18632/oncotarget.4947)
Cerutti JM, Delcelo R, Amadei MJ, Nakabashi C, Maciel RMB, Peterson B, Shoemaker J & Riggins GJ 2004 A preoperative diagnostic test that distinguishes benign from malignant thyroid carcinoma based on gene expression. Journal of Clinical Investigation 113 1234–1242. (https://doi.org/10.1172/JCI19617)
Cerutti JM, Latini FRM, Nakabashi C, Delcelo R, Andrade VP, Amadei MJ, Maciel RMB, Hojaij FC, Hollis D, Shoemaker J, et al.2006 Diagnosis of suspicious thyroid nodules using four protein biomarkers. Clinical Cancer Research 12 3311–3318. (https://doi.org/10.1158/1078-0432.CCR-05-2226)
Cerutti JM, Oler G, Delcelo R, Gerardt R, Michaluart P, De Souza SJ, Galante PAF, Huang P & Riggins GJ 2011 PVALB, a new Hürthle adenoma diagnostic marker identified through gene expression. Journal of Clinical Endocrinology and Metabolism 96 E151–E160. (https://doi.org/10.1210/jc.2010-1318)
Evstafieva AG, Kovaleva IE, Shoshinova MS, Budanov AV & Chumakov PM 2018 Implication of KRT16, FAM129A and HKDC1 genes as ATF4 regulated components of the integrated stress response. PLoS ONE 13 e0191107. (https://doi.org/10.1371/journal.pone.0191107)
Furuta S, Hidaka E, Ogata A, Yokota S & Kamata T 2004 Ras is involved in the negative control of autophagy through the class I PI3-kinase. Oncogene 23 3898–3904. (https://doi.org/10.1038/sj.onc.1207539)
Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, Pacini F, Randolph GW, Sawka AM, Schlumberger M, et al.2016 2015 American Thyroid Association management guidelines for adult patients with thyroid nodules and differentiated thyroid cancer: the American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 26 1–133. (https://doi.org/10.1089/thy.2015.0020)
He X, Saji M, Radhakrishnan D, Romigh T, Ngeow J, Yu Q, Wang Y, Ringel MD & Eng C 2012 PTEN lipid phosphatase activity and proper subcellular localization are necessary and sufficient for down-regulating AKT phosphorylation in the nucleus in Cowden syndrome. Journal of Clinical Endocrinology and Metabolism 97 E2179–E2187. (https://doi.org/10.1210/jc.2012-1991)
Howlader N, Noone A, Krapcho M, Garshell J, Miller D, Altekruse S, Kosary C, Yu M, Ruhl J, Tatalovich Z, et al.2015 SEER Cancer Statistics Review, 1975–2012, pp 1–101. National Cancer Institute. (available at: https://seer.cancer.gov/csr/1975_2012/)
Ito S, Fujii H, Matsumoto T, Abe M, Ikeda K & Hino O 2009 Frequent expression of Niban in head and neck squamous cell carcinoma and squamous dysplasia. Head and Neck 32 96–103. (https://doi.org/10.1002/hed.21153)
Ji H, Ding Z, Hawke D, Xing D, Jiang B-H, Mills GB & Lu Z 2012 AKT-dependent phosphorylation of Niban regulates nucleophosmin- and MDM2-mediated p53 stability and cell apoptosis. EMBO Reports 13 554–560. (https://doi.org/10.1038/embor.2012.53)
Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, Adachi H, Adams CM, Adams PD, Adeli K, et al.2016 Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 12 1–222. (https://doi.org/10.1080/15548627.2015.1100356)
Kroemer G, Mariño G & Levine B 2010 Autophagy and the integrated stress response. Molecular Cell 40 280–293. (https://doi.org/10.1016/j.molcel.2010.09.023)
La Vecchia C, Malvezzi M, Bosetti C, Garavello W, Bertuccio P, Levi F & Negri E 2015 Thyroid cancer mortality and incidence: a global overview. International Journal of Cancer 136 2187–2195. (https://doi.org/10.1002/ijc.29251)
Liu X, Medici M, Kwong N, Angell TE, Marqusee E, Kim MI, Larsen PR, Cho NL, Nehs MA, Ruan DT, et al.2016 Bethesda categorization of thyroid nodule cytology and prediction of thyroid cancer type and prognosis. Thyroid 26 256–261. (https://doi.org/10.1089/thy.2015.0376)
Majima S, Kajino K, Fukuda T, Otsuka F & Hino O 2000 A novel gene ‘Niban’ upregulated in renal carcinogenesis: cloning by the cDNA-amplified fragment length polymorphism approach. Japanese Journal of Cancer Research 91 869–874. (https://doi.org/10.1111/j.1349-7006.2000.tb01027.x)
Malaguarnera R, Chen K-Y, Kim T-Y, Dominguez JM, Voza F, Ouyang B, Vundavalli SK, Knauf JA & Fagin JA 2014 Switch in signaling control of mTORC1 activity after oncoprotein expression in thyroid cancer cell lines. Journal of Clinical Endocrinology and Metabolism 99 E1976–E1987. (https://doi.org/10.1210/jc.2013-3976)
Matsumoto F, Fujii H, Abe M, Kajino K, Kobayashi T, Matsumoto T, Ikeda K & Hino O 2006 A novel tumor marker, Niban, is expressed in subsets of thyroid tumors and Hashimoto’s thyroiditis. Human Pathology 37 1592–1600. (https://doi.org/10.1016/j.humpath.2006.06.022)
Mendes TB, Nozima BH, Budu A, de Souza RB, Braga Catroxo MH, Delcelo R, Gazarini ML & Cerutti JM 2016 PVALB diminishes [Ca2+] and alters mitochondrial features in follicular thyroid carcinoma cells through AKT/GSK3β pathway. Endocrine-Related Cancer 23 769–782. (https://doi.org/10.1530/ERC-16-0181)
Morani F, Titone R, Pagano L, Galetto A, Alabiso O, Aimaretti G & Isidoro C 2014 Autophagy and thyroid carcinogenesis: genetic and epigenetic links. Endocrine-Related Cancer 21 R13–R29. (https://doi.org/10.1530/ERC-13-0271)
Narita M, Young ARJ & Narita M 2009 Autophagy facilitates oncogene-induced senescence. Autophagy 5 1046–1047. (https://doi.org/10.4161/auto.5.7.9444)
Netea-Maier RT, Kluck V, Plantinga TS & Smit JWA 2015 Autophagy in thyroid cancer: present knowledge and future perspectives. Frontiers in Endocrinology 6 1–14. (https://doi.org/10.3389/fendo.2015.00022)
Pereira GJS, Antonioli M, Hirata H, Ureshino RP, Nascimento AR, Bincoletto C, Vescovo T, Piacentini M, Maria Fimia G & Smaili SS 2017 Glutamate induces autophagy via the two-pore channels in neural cells. Oncotarget 8 12730–12740. (https://doi.org/10.18632/oncotarget.14404)
Qin L, Wang Z, Tao L & Wang Y 2010 ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy 6 239–247. (https://doi.org/10.4161/auto.6.2.11062)
Qu X, Yu J, Bhagat G, Furuya N, Hibshoosh H, Troxel A, Rosen J, Eskelinen EL, Mizushima N, Ohsumi Y, et al.2003 Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. Journal of Clinical Investigation 112 1809–1820. (https://doi.org/10.1172/JCI200320039)
Sun GD, Kobayashi T, Abe M, Tada N, Adachi H, Shiota A, Totsuka Y & Hino O 2007 The endoplasmic reticulum stress-inducible protein Niban regulates eIF2α and S6K1/4E-BP1 phosphorylation. Biochemical and Biophysical Research Communications 360 181–187. (https://doi.org/10.1016/j.bbrc.2007.06.021)
Thomas BC, Kay JD, Menon S, Vowler SL, Dawson SN, Bucklow LJ, Luxton HJ, Johnston T, Massie CE, Pugh M, et al.2016 Whole blood mRNA in prostate cancer reveals a four-gene androgen regulated panel. Endocrine-Related Cancer 23 797–812. (https://doi.org/10.1530/ERC-16-0287)
Ueno T, Sato W, Horie Y, Komatsu M, Tanida I, Yoshida M, Ohshima S, Mak TW, Watanabe S & Kominami E 2008 Loss of Pten, A tumor suppressor, causes the strong inhibition of autophagy without affecting LC3 lipidation. Autophagy 4 692–700. (https://doi.org/10.4161/auto.6085)
Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, et al.2015 Proteomics. Tissue-based map of the human proteome. Science 347 1260419. (https://doi.org/10.1126/science.1260419)
Vizioli MG, Possik PA, Tarantino E, Meissl K, Borrello MG, Miranda C, Anania MC, Pagliardini S, Seregni E, Pierotti MA, et al.2011 Evidence of oncogene-induced senescence in thyroid carcinogenesis. Endocrine-Related Cancer 18 743–757. (https://doi.org/10.1530/ERC-11-0240)
Weckman A, Rotondo F, Di Ieva A, Syro LV, Butz H, Cusimano MD & Kovacs K 2015 Autophagy in endocrine tumors. Endocrine-Related Cancer 22 R205–R218. (https://doi.org/10.1530/ERC-15-0042)
Zhao J & Goldberg AL 2016 Coordinate regulation of autophagy and the ubiquitin proteasome system by MTOR. Autophagy 12 1967–1970. (https://doi.org/10.1080/15548627.2016.1205770)
