Abstract
Aggressive pheochromocytomas and paragangliomas (PPGLs) are difficult to treat, and molecular targeting is being increasingly considered, but with variable results. This study investigates established and novel molecular-targeted drugs and chemotherapeutic agents for the treatment of PPGLs in human primary cultures and murine cell line spheroids. In PPGLs from 33 patients, including 7 metastatic PPGLs, we identified germline or somatic driver mutations in 79% of cases, allowing us to assess potential differences in drug responsivity between pseudohypoxia-associated cluster 1-related (n = 10) and kinase signaling-associated cluster 2-related (n = 14) PPGL primary cultures. Single anti-cancer drugs were either more effective in cluster 1 (cabozantinib, selpercatinib, and 5-FU) or similarly effective in both clusters (everolimus, sunitinib, alpelisib, trametinib, niraparib, entinostat, gemcitabine, AR-A014418, and high-dose zoledronic acid). High-dose estrogen and low-dose zoledronic acid were the only single substances more effective in cluster 2. Neither cluster 1- nor cluster 2-related patient primary cultures responded to HIF-2a inhibitors, temozolomide, dabrafenib, or octreotide. We showed particular efficacy of targeted combination treatments (cabozantinib/everolimus, alpelisib/everolimus, alpelisib/trametinib) in both clusters, with higher efficacy of some targeted combinations in cluster 2 and overall synergistic effects (cabozantinib/everolimus, alpelisib/trametinib) or synergistic effects in cluster 2 (alpelisib/everolimus). Cabozantinib/everolimus combination therapy, gemcitabine, and high-dose zoledronic acid appear to be promising treatment options with particularly high efficacy in SDHB-mutant and metastatic tumors. In conclusion, only minor differences regarding drug responsivity were found between cluster 1 and cluster 2: some single anti-cancer drugs were more effective in cluster 1 and some targeted combination treatments were more effective in cluster 2.
Introduction
Pheochromocytomas (PCCs) and paragangliomas (PGLs), collectively referred to as PPGLs, are rare endocrine tumors originating from neural crest-derived cells of the adrenal medulla or the sympathetic or parasympathetic paraganglia. Approximately 10–15% of PCCs and 35–40% of PGLs are metastatic (Goldstein et al. 1999, Mannelli et al. 1999, Eisenhofer et al. 2012, Crona et al. 2019, Bechmann et al. 2020), defined as the presence of metastases in lymph nodes or other distant sites, particularly bones (Lam 2017). The median overall survival of patients with metastatic PPGLs has been reported to be 7 years (Hescot et al. 2019), with a 5-year mortality rate of 37% (Turkova et al. 2016, Hamidi et al. 2017).
PPGLs have the highest degree of heritability among all tumor entities: 30–35% show identifiable germline mutations and another 35–40% somatic driver mutations in known susceptibility genes (Burnichon et al. 2011, Luchetti et al. 2015, Fishbein et al. 2017, Gieldon et al. 2019, Jiang et al. 2020). Therefore, around 70% of all PPGLs can be assigned to one of three main molecular clusters with different gene expression signatures and clinical behavior (Fig. 1). Pseudohypoxia-associated cluster 1 is subdivided into cluster 1A (Krebs cycle-related) and cluster 1B (hypoxia signaling related). Cluster 1-related mutations lead to hypoxia-inducible factor (HIF) 2α stabilization and accumulation which promote angiogenesis, tumor cell migration and invasion, extravasation, and metastasis (Keith et al. 2011, Bechmann et al. 2020). Accounting for around 50–60% of all metastatic tumors, cluster 1-related PPGLs have the highest metastatic risk, with up to 75% showing metastases (John et al. 1999, Turkova et al. 2016, Crona et al. 2019, Bechmann et al. 2020). Around 2–4% of metastatic tumors belong to the kinase signaling-associated cluster 2 (metastatic risk 2–12%) (Crona et al. 2019, Bechmann et al. 2020). Cluster 3 mutations of Wnt signaling-related genes have been revealed to play an active role in PPGL pathogenesis and are associated with aggressive behavior and high metastatic risk (Fishbein et al. 2017, Alzofon et al. 2021). Knowledge of a tumor’s molecular cluster guides informed personalized management of PPGLs. Although cluster-specific diagnostics (biochemistry, imaging) and follow-up have entered clinical routine (Nölting et al. 2019, 2022), therapy is largely not as yet cluster-specific.
PPGL molecular clusters 1, 2, and 3, including their associated loss- or gain-of-function mutations (green), and potential informed targeted treatment options (red). Pseudohypoxia-associated cluster 1 is subdivided into cluster 1A (Krebs cycle related) and cluster 1B (VHL/EPAS1 hypoxia signaling related). Cluster 1A involves mutations in genes encoding for succinate dehydrogenase subunits and succinate dehydrogenase complex assembly factor-2 (SDHA[AF2]/B/C/D), fumarate hydratase (FH), malate dehydrogenase 2 (MDH2), isocitrate dehydrogenase 1 (IDH), mitochondrial glutamicoxaloacetic transaminase (GOT2), 2-oxoglutarate-malate carrier (SLC25A11), dihydrolipoamide S-succinyltransferase (DLST), and succinate-CoA ligase GDP-forming subunit beta (SUCLG2). Cluster 1B comprises mutations in Egl-9 prolyl hydroxylase-1 and -2 (EGLN1/2 encoding PHD1/2), von Hippel-Lindau (VHL), hypoxia-inducible factor 2α (HIF2A/EPAS1), and iron regulatory protein 1 (IRP1). The kinase signaling-associated cluster 2 includes mutations in the rearranged during transfection proto-oncogene (RET), neurofibromin 1 (NF1), HRAS,transmembrane protein 127 (TMEM127), Myc-associated factor X (MAX), and fibroblast growth factor receptor 1 (FGFR1), and in rare cases in Met, MERTK, BRAF, and the nerve growth factor receptor (NGFR), which leads to overactivation of the PI3K/AKT, mTORC1/p70S6K, and RAS/RAF/MEK/ERK (MAPK) signaling pathways. Wnt signaling-associated cluster 3 comprises mutations in cold shock domain-containing E1 (CSDE1), ‘mastermind-like’ transcriptional coactivator 3 (MAML3). ⇧ denotes protein activation/upregulation; ⊥ denotes protein inhibition; ⦸ denotes tumor-promoting loss-of-function mutation; ◯ denotes tumor-promoting gain-of-function mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
PPGL molecular clusters 1, 2, and 3, including their associated loss- or gain-of-function mutations (green), and potential informed targeted treatment options (red). Pseudohypoxia-associated cluster 1 is subdivided into cluster 1A (Krebs cycle related) and cluster 1B (VHL/EPAS1 hypoxia signaling related). Cluster 1A involves mutations in genes encoding for succinate dehydrogenase subunits and succinate dehydrogenase complex assembly factor-2 (SDHA[AF2]/B/C/D), fumarate hydratase (FH), malate dehydrogenase 2 (MDH2), isocitrate dehydrogenase 1 (IDH), mitochondrial glutamicoxaloacetic transaminase (GOT2), 2-oxoglutarate-malate carrier (SLC25A11), dihydrolipoamide S-succinyltransferase (DLST), and succinate-CoA ligase GDP-forming subunit beta (SUCLG2). Cluster 1B comprises mutations in Egl-9 prolyl hydroxylase-1 and -2 (EGLN1/2 encoding PHD1/2), von Hippel-Lindau (VHL), hypoxia-inducible factor 2α (HIF2A/EPAS1), and iron regulatory protein 1 (IRP1). The kinase signaling-associated cluster 2 includes mutations in the rearranged during transfection proto-oncogene (RET), neurofibromin 1 (NF1), HRAS,transmembrane protein 127 (TMEM127), Myc-associated factor X (MAX), and fibroblast growth factor receptor 1 (FGFR1), and in rare cases in Met, MERTK, BRAF, and the nerve growth factor receptor (NGFR), which leads to overactivation of the PI3K/AKT, mTORC1/p70S6K, and RAS/RAF/MEK/ERK (MAPK) signaling pathways. Wnt signaling-associated cluster 3 comprises mutations in cold shock domain-containing E1 (CSDE1), ‘mastermind-like’ transcriptional coactivator 3 (MAML3). ⇧ denotes protein activation/upregulation; ⊥ denotes protein inhibition; ⦸ denotes tumor-promoting loss-of-function mutation; ◯ denotes tumor-promoting gain-of-function mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
PPGL molecular clusters 1, 2, and 3, including their associated loss- or gain-of-function mutations (green), and potential informed targeted treatment options (red). Pseudohypoxia-associated cluster 1 is subdivided into cluster 1A (Krebs cycle related) and cluster 1B (VHL/EPAS1 hypoxia signaling related). Cluster 1A involves mutations in genes encoding for succinate dehydrogenase subunits and succinate dehydrogenase complex assembly factor-2 (SDHA[AF2]/B/C/D), fumarate hydratase (FH), malate dehydrogenase 2 (MDH2), isocitrate dehydrogenase 1 (IDH), mitochondrial glutamicoxaloacetic transaminase (GOT2), 2-oxoglutarate-malate carrier (SLC25A11), dihydrolipoamide S-succinyltransferase (DLST), and succinate-CoA ligase GDP-forming subunit beta (SUCLG2). Cluster 1B comprises mutations in Egl-9 prolyl hydroxylase-1 and -2 (EGLN1/2 encoding PHD1/2), von Hippel-Lindau (VHL), hypoxia-inducible factor 2α (HIF2A/EPAS1), and iron regulatory protein 1 (IRP1). The kinase signaling-associated cluster 2 includes mutations in the rearranged during transfection proto-oncogene (RET), neurofibromin 1 (NF1), HRAS,transmembrane protein 127 (TMEM127), Myc-associated factor X (MAX), and fibroblast growth factor receptor 1 (FGFR1), and in rare cases in Met, MERTK, BRAF, and the nerve growth factor receptor (NGFR), which leads to overactivation of the PI3K/AKT, mTORC1/p70S6K, and RAS/RAF/MEK/ERK (MAPK) signaling pathways. Wnt signaling-associated cluster 3 comprises mutations in cold shock domain-containing E1 (CSDE1), ‘mastermind-like’ transcriptional coactivator 3 (MAML3). ⇧ denotes protein activation/upregulation; ⊥ denotes protein inhibition; ⦸ denotes tumor-promoting loss-of-function mutation; ◯ denotes tumor-promoting gain-of-function mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Apart from high-specific activity [131I]-MIBG therapy – approved only in the United States – there are neither approved nor highly effective therapies available for metastatic PPGLs. In clinical practice, conventional chemotherapy with cyclophosphamide, vincristine, and dacarbazine (CVD) is used in patients with rapidly progressive metastatic PPGL with a high tumor burden, while watchful waiting or radionuclide therapy is the recommended first-line option for patients with slow or moderate disease progression (Fassnacht et al. 2020, Lenders et al. 2020, Nölting et al. 2022). In the cases of further progression, the tyrosine kinase inhibitors (TKI) sunitinib or cabozantinib, or the chemotherapeutic temozolomide, can be used (Ayala-Ramirez et al. 2012, Hadoux et al. 2014, Jimenez et al. 2017, O’Kane et al. 2019, Baudin et al. 2021).
Therefore, there is a considerable clinical need for novel therapeutic strategies and more effective treatment options, especially for metastatic PPGLs, which would ideally be individualized. Given the lack of reliable human PPGL cell models, we have established a model to perform individualized drug testing in patient-derived PPGL primary cultures (Fankhauser et al. 2019), which has been designated as a very promising in vitro model (Bayley & Devilee 2020).
After publishing preliminary data from six non-metastatic tumors (Fankhauser et al. 2019), we have now expanded our studies (n = 33) allowing us to compare the drug responsivity of cluster 1- (n = 10) with the drug responsivity of cluster 2-related PPGLs (n = 14). Seven of the included primary cultures are from metastatic PPGLs (n = 3 cluster 1, n = 4 non-defined).
Materials and methods
This study was approved by the local ethics committee of both partaking centers (Ethikkommission der Medizinischen Fakultät der LMU München, Projekt-Nr. 379-10 and Kantonale Ethikkommission Zürich, BASEC 2017-00771) and by ENS@T (European Network for the Study of Adrenal Tumors). Written informed consent was obtained from each patient prior to participation.
Human PPGL two-dimensional primary cultures and murine MPC cell lines
Fresh primary tumor tissues were obtained directly after surgery from 33 PPGL patients at the University Hospitals of LMU Munich (n = 25) and USZ Zurich (n = 8) and numbered consecutively. PPGL primary cultures were isolated using collagenase and red blood cell lysis buffer, incubated for 72 h after seeding and then treated for 72 h with inhibitors listed below (DMSO used as control). Murine pheochromocytoma cell lines (MPC) were cultivated and treated with inhibitors for up to 14 days. Both primary and murine cell viabilities were assessed as previously described (Fankhauser et al. 2019). In order to avoid fibroblast overgrowth in the primary cultures, we performed these short-term experiments. We did not observe fibroblast overgrowth on day 8 of cultivation, but it was seen on day 16 of cultivation in the untreated PPGL primary cultures. Other studies have also described fibroblast overgrowth after 15 days of cultivation (April-Monn et al. 2021).
Human PPGL three-dimensional primary cultures
Primary cell isolation was carried out using the gentleMACS™ Octo Dissociator with Heaters (Miltenyi Biotec, Germany) together with the human Tumor Dissociation Kit (Miltenyi Biotec). Single-cell suspensions were incubated with RBCLB for 3 min. Primary cells (2 × 104 per well) were plated in a 96-well Ultra-Low Attachment plate (Corning) and incubated for 6 days to allow spheroid formation. Subsequently, cells were treated with drugs for 72 h, and cell viability was assessed after 0, 24, 48, and 72 h using RealTime-Glo™ MT Cell Viability Assay (Promega).
Inhibitors and treatment concentrations
Eighteen different drugs were tested alone and in combination. Drugs targeting cluster 2 include cabozantinib and sunitinib, selpercatinib (LOXO-292), alpelisib (BYL719), everolimus, dabrafenib, trametinib, and AR-A014418. Drugs targeting cluster 1 include temozolomide, niraparib, entinostat, gemcitabine and 5-fluorouracil (5-FU), octreotide, TC-S 7009, and belzutifan (MK6482/PT2977). Other drugs include zoledronic acid and estradiol. The drugs were purchased from Selleckchem (Houston, TX, USA), Hycultec (Beutelsbach, Germany), and Lucerna-Chem (Lucerne, Switzerland) and dissolved in DMSO. In general, we used drug concentrations to approximate the average plasma concentrations measured in patients after therapy (Supplementary Table 1, see section on supplementary materials given at the end of this article). If this information was not available from previous studies or if these doses were not effective (in rare cases), we then performed drug dose–response curves to identify the effective concentrations in vitro (Supplementary Fig. 1).
Genetic testing
Targeted next-generation sequencing (NGS), used to identify somatic variants in tumors, was conducted with a custom multi-gene panel covering 84 genes (Gieldon et al. 2019) or the human comprehensive cancer panel (Qiagen, DHS-3501Z), covering 306 cancer-associated genes. In both panels, known PPGL susceptibility genes (NF1, RET, TMEM127, VHL, FH, SDHA, SDHB, SDHC, SDHD, SDHAF2,andMAX), as well as commonly known oncogenes and tumor suppressor genes, were included. Sequencing and analysis were performed as previously described (Gieldon et al. 2019). Classification of identified variants was performed following the standards and guidelines of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology(ACMG-AMP) (Richards et al. 2015).
Germline testing was performed during routine clinical practice in the respective centers of human genetics using patient blood samples.
Generation and validation of Sdhb knockdowns in murine MPC cells
Mouse PCC cells, MPC 4/30/PRR, and MPC cells with stable expression of HIF-2a (MPC mCherry H2A/EV) were cultivated as previously described (Bechmann et al. 2019). Five single-guide RNA (sgRNA) specific to Sdhb were cloned into pLenti SpBsmBI sgRNA Puro (provided by Rene Maehr; Addgene plasmid #62207) (Pham et al. 2016). After initial testing, two sgRNA were chosen for further use (sgRNA-2: ACCTCGAATGCAGACGTACG; sgRNA-3: TGCGCCATGAACATCAACGG). Components of the CRISPR/Cas9 system were stably introduced into MPC cells by two subsequent lentiviral transductions. First Cas9 from Streptococcus pyogenes was transduced using vector Lenti‐Cas9‐2A‐Blast (provided by Jason Moffat; Addgene plasmid) (Hart et al. 2015). Positively transduced cells were selected by 2 µg/mL blasticidin treatment and then transduced with sgRNA specific for Sdhbor with the vector without sgRNA. After puromycin (0.5 µg/mL) selection, cell lines MPC-Cas9-sgRNA2, MPC-Cas9-sgRNA3, and MPC-Cas9-control were obtained (Supplementary Fig. 2).
Spheroid cultivation and treatment
Spheroids of different MPC sub-cell lines were generated (500 cells/spheroid) and cultivated as previously described (Bechmann et al. 2018, 2019). Four days after seeding, spheroids were treated with selected drugs. DMSO was used as the control. Average spheroid diameters were measured 14 days after seeding using ImageJ Software (single treatment). Diameters were given relative to DMSO-treated spheroids to account for different growth behaviors of the different cell lines.
SDS-PAGE and Western blot analysis
Cells were seeded into six-well plates (300,000–500,000 cells/well) and treated with selected inhibitors the following day. After 24 or 72 h, cell lysis was performed using a 1:100 dilution of Halt™ Protease and Phosphatase Inhibitor Cocktail (100×) with M-PER™ Mammalian Protein Extraction Reagent, both purchased from Thermo Scientific. Western blotting was then conducted as previously described (Jin et al. 2020). Supplementary Table 2 lists the applied antibodies. Protein bands were visualized using chemiluminescence imaging system ECL Chemocam imager (INTAS, Göttingen, Germany) and Western blot quantification was performed.
For the validation of Sdhb knockouts in MPC cells, SDHB protein levels were quantified in three different passages of the cell lines by Western blotting using anti-SDHB (ab14714, Abcam) and anti-actin (MAB1501R, Millipore) antibodies. Densitometry on Western blot images was performed using ImageJ software.
Statistical analysis
Each cell viability experiment consisted of four samples per drug concentration. All results are displayed as the mean ± s.d. Efficacy was described as poor (<25% cell viability reduction), moderate (25–50% cell viability reduction), and strong (>50% cell viability reduction). Statistical calculations were made using R 4.0 (R Foundation for Statistical Computing, Vienna, Austria). Wald tests were used for the treatment comparisons. Synergism was assessed as previously described (Slinker 1998, Fankhauser et al. 2019). ‘Synergistic effects’ were confirmed when single effects were significant and interaction effects were both negative and significant. ‘Additive effects’ were defined as significant single effects but non-significant interaction effects. ‘Antagonistic effects’ were defined as significant single effects and both positive and significant interaction effects. Statistical significance was set at P < 0.05. Due to the exploratory nature of the study, no adjustment for multiple testing was done.
Results
Tumor characteristics, mutational status, and biochemical phenotypes
Genetics
We established human PPGL primary cultures (25 PCCs, 8 PGLs) from 33 individual patients, including 7 metastatic PPGLs (21%, 3 PGLs, 4 PCCs; Table 1). Germline or somatic mutations were found in 79% (26/33) of tumors, with 76% (25/33) in known PPGL susceptibility genes (Fig. 2). The somatic and germline mutations identified in the different tumors are summarized in Table 1. Altogether, 10 clusters 1 mutations (36%), 14 clusters 2 mutations (50%), 2 secondary modifier mutations (ATRX; 7%), and 2 potential driver mutations which have not previously been described in PPGL (ATM, MPL; 7%) were identified. Two tumors showed double mutations. In seven tumors, no known PPGL driver mutations were found.
Distribution of somatic and germline mutations in 25/33 PPGL samples with mutations in known PPGL susceptibility genes (76%). Cluster 1 mutations were identified in 10 samples, cluster 2 mutations were identified in 14 samples, and secondary modifier mutations were identified in 2 samples. Double mutations were found in 2 samples. Not shown: two samples with mutations in unknown PPGL susceptibility genes (MPL, ATM). *Most likely pathogenic mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Distribution of somatic and germline mutations in 25/33 PPGL samples with mutations in known PPGL susceptibility genes (76%). Cluster 1 mutations were identified in 10 samples, cluster 2 mutations were identified in 14 samples, and secondary modifier mutations were identified in 2 samples. Double mutations were found in 2 samples. Not shown: two samples with mutations in unknown PPGL susceptibility genes (MPL, ATM). *Most likely pathogenic mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Distribution of somatic and germline mutations in 25/33 PPGL samples with mutations in known PPGL susceptibility genes (76%). Cluster 1 mutations were identified in 10 samples, cluster 2 mutations were identified in 14 samples, and secondary modifier mutations were identified in 2 samples. Double mutations were found in 2 samples. Not shown: two samples with mutations in unknown PPGL susceptibility genes (MPL, ATM). *Most likely pathogenic mutation.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Human PPGL primary cultures patient cohort (n = 33).
| Patient ID | Sex | Age (years) | Histology and tumor characteristics | Ki-67 (%) | Biochemical phenotype | Tumor sequencing | Germline status |
|---|---|---|---|---|---|---|---|
| 4a | m | 82 | PCC, 1.5 cm, capsule infiltration | 1–2 | Adrenergic | No mutation | No mutation |
| 5a | m | 50 | PCC, 12.9 cm | 1–2 | Adrenergic | NF1 | n/a |
| 6a | f | 73 | PCC, 3.9 cm | 2 | Adrenergic | NF1 | Somatic |
| 7a | m | 26 | PCC, 4 cm, angioinvasion | <5 | Noradrenergic | No mutation | No mutation |
| 10a | m | 65 | PCC, bilateral, right 5.7 cm and left 2.1 cm, PASS 3 | <1 | Noradrenergic | VHL, ATRX | n/a |
| 11a | m | 59 | PCC, 5.5 cm, capsule infiltration, angioinvasion, PASS 2 | <1 | Adrenergic | BRAFV601 | n/a |
| 12 | f | 36 | PCC, 6 cm | <2 | Adrenergic | RET:p.C618S | Germline (MEN2A) |
| 13 | f | 58 | PGL, metastatic (liver, lymph node, muscle), max. 9.5 cm, muscle infiltration, angioinvasion | n/a | Noradrenergic | No mutation | No mutation |
| 16 | m | 58 | PCC, 3.7 cm | low | Noradrenergic | SDHC | Germline |
| 18 | m | 25 | PCC, 2.6 cm or 1.9 cm | 1–2 | Adrenergic | RET:p.C634A, ATM | Germline (MEN2A) |
| 19 | f | 41 | PCC, 9 cm | 1–2 | Adrenergic | NF1 | Somatic |
| 20 | m | 52 | PCC, 8.2 cm | <1 | Adrenergic | NF1 | Somatic |
| 21 | f | 70 | PGL, nonfunctioning, abdominal, 4.2 cm, R1 | 1 | Silent | No mutation | No mutation |
| 22 | f | 41 | PGL, extra/periadrenal, 1.7 cm, and PCC 6 mm, R1 | 1 | Adrenergic | RET:p.C634T | Germline (MEN2A) |
| 23 | f | 19 | PCC, max. 6.1 cm | n/a | Noradrenergic | VHL | Somatic |
| 24 | m | 57 | PCC, 2.7 cm | <1 | Adrenergic | MPL | Somatic |
| 26 | f | 34 | PGL, abdominal, max. 4.5 cm | 4 | Noradrenergic | VHL | Germline |
| 27 | m | 53 | PCC, metastatic (lung, bone), 5.2 cm, angioinvasion, PASS 15 | 80 | Noradrenergic | ATRX | Somatic |
| 30 | m | 62 | PCC, max. 6.7 cm, PASS 0 | n/a | Noradrenergic | TMEM127 | Somatic |
| 32 | f | 58 | PCC, max. 3.3 cm | n/a | Noradrenergic | VHL | n/a |
| 33 | f | 55 | PCC, max. 12.6 cm | <1 | Adrenergic | NF1 | n/a |
| 34 | f | 50 | PCC, metastatic (liver, lymph node, bone), 16.9 cm, GAPP 8 | 10 | Noradrenergic | No mutation (VUS SDHA b) | No mutation |
| 36 | f | 33 | PCC, metastatic (bone, paravertebral) | 15 | Noradrenergic | SDHB | Germline |
| 37 | m | 38 | PGL, metastatic (liver, lymph node, bone), 8 cm, infiltration of liver and vena cava, GAPP 8, immunohistochemical SDHB-loss | 5 | Noradrenergic | SDHB | Germline |
| 38 | f | 63 | PCC, max. 2.2 cm | 1–2 | Noradrenergic | EPAS1 | Somatic |
| 40 | f | 38 | PCC, 7 cm, PASS 3 | <1 | Adrenergic | NF1 | Somatic |
| 42 | f | 74 | PCC, 5.4 cm, lymphatic invasion | 10 | Noradrenergic | VUS RETc | Somatic |
| 44 | f | 49 | PCC, 4 cm | <2 | Adrenergic | HRAS | Somatic |
| 45 | m | 76 | PCC, 2.8 cm, angioinvasion, SSTR2 expression negative | <1 | Noradrenergic | No mutation | No mutation |
| 46 | f | 62 | PCC, micrometastases (lung), 9.8 cm, angioinvasion | 2–3 | Adrenergic | No mutation | No mutation |
| 47 | f | 27 | PGL, head/neck, 2.7 cm, immunohistochemical SDHB-loss | n/a | Silent | SDHB | Germline |
| 48 | f | 47 | PGL, head/neck, metastatic (bone), 1.2 cm | n/a | Silent | SDHB (VUS EPAS1 d) | Germline |
| 49 | m | 36 | PGL, head/neck, 2.1 cm | n/a | Silent | NF1 | Somatic |
| Total | 14 m, 19 f | median age: 52 | 25 PCCs, 8 PGLs, 7 metastatic PPGLs | 14 adrenergic, 15 noradrenergic, 4 silent | 12 somatic, 9 germline, 5 unknown |
aPreviously published data (Fankhauser et al. 2019). bSDHA:c.1232G>A (p.Gly411Asp). Succinate:fumarate unremarkable. cMost likely pathogenic mutation. dClinical interpretation unclear, mutation mentioned for information.
Male (m), female (f), pheochromocytoma (PCC), paraganglioma (PGL), pheochromocytoma and paraganglioma (PPGL), next-generation sequencing (NGS), not available (n/a).
Biochemical and clinical phenotypes in different clusters
Cluster 1 PPGLs are regularly associated with noradrenergic (elevated plasma concentrations of normetanephrine and no or relatively small increases in metanephrine) and cluster 2 PPGLs with adrenergic (plasma metanephrines that exceed 5% relative to the sum of metanephrines and normetanephrines) phenotypes.
All cluster 1-associated PPGL patients (n = 10) presented with noradrenergic phenotypes, except for two biochemically silent head-and-neck PGL (HNPGL) patients (47 and 48). All cluster 2-associated PPGL patients (n = 14), apart from patients 30 (TMEM127-mutant, noradrenergic), 42 (RET (VUS)-mutant, noradrenergic), and 49 (NF1-mutant HNPGL, biochemically silent), showed adrenergic phenotypes. In patients without cluster affiliations, ATRX mutations were associated with noradrenergic and the MPL mutation with adrenergic phenotypes. As expected from other studies, metastatic PPGLs - except for one (patient 46) - had noradrenergic phenotypes.
SSTR2 baseline expression in patient primary cultures
Currently there is no evidence for direct transferability of primary culture data to patient care. Two anecdotal reports indicate transferability of primary culture data to patient management.
PGL patient 13
Patient 13, without a known PPGL susceptibility mutation, presented with recurrent liver, lymph node, and abdominal metastases from a primarily resected PGL. Somatostatin receptor (SSTR)-based radionuclide imaging showed SSTR2 positivity. Baseline SSTR2 expression by Western blot analysis was notably higher compared to most other primary cultures (n = 16; Fig. 3A and B). SSTR2-targeted radionuclide therapy (PRRT) was clinically applied as first-line systemic therapy; follow-up staging indicated a complete biochemical (decrease of plasma free normetanephrines from 1020 ng/L to 239 ng/L) and almost complete radiological response (Fig. 3C).
Baseline SSTR2 protein levels in relation to TCE protein levels (A) and baseline SSTR2 quantification (B) of the PPGL primary cultures (n = 16). Significantly higher SSTR2 expressions were found in the metastatic PGL primary cultures of patients 13 and 21 and the PCC primary culture of patient 32 compared to the other PPGL primary cultures. (C) Ga-68 DOTA-TOC PET/CT imaging of patient 13 prior to and after two and three cycles of SSTR2-guided peptide receptor radionuclide therapy (PRRT) and F-18-SiFA-TATE PET/CT imaging of patient 34 prior to and after two cycles of PRRT. After two to three cycles of PRRT, Ga-DOTA-TOC PET/CT of patient 13 showed a significant decrease of tumor burden. Patient 13 also had a strong biochemical therapy response with a near normalization of plasma free normetanephrines (239 ng/L) from initial values of 1020 ng/L. In contrast, F-18-SiFA-TATE PET/CT of patient 34 showed slightly progressive disease after two cycles of PRRT.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Baseline SSTR2 protein levels in relation to TCE protein levels (A) and baseline SSTR2 quantification (B) of the PPGL primary cultures (n = 16). Significantly higher SSTR2 expressions were found in the metastatic PGL primary cultures of patients 13 and 21 and the PCC primary culture of patient 32 compared to the other PPGL primary cultures. (C) Ga-68 DOTA-TOC PET/CT imaging of patient 13 prior to and after two and three cycles of SSTR2-guided peptide receptor radionuclide therapy (PRRT) and F-18-SiFA-TATE PET/CT imaging of patient 34 prior to and after two cycles of PRRT. After two to three cycles of PRRT, Ga-DOTA-TOC PET/CT of patient 13 showed a significant decrease of tumor burden. Patient 13 also had a strong biochemical therapy response with a near normalization of plasma free normetanephrines (239 ng/L) from initial values of 1020 ng/L. In contrast, F-18-SiFA-TATE PET/CT of patient 34 showed slightly progressive disease after two cycles of PRRT.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Baseline SSTR2 protein levels in relation to TCE protein levels (A) and baseline SSTR2 quantification (B) of the PPGL primary cultures (n = 16). Significantly higher SSTR2 expressions were found in the metastatic PGL primary cultures of patients 13 and 21 and the PCC primary culture of patient 32 compared to the other PPGL primary cultures. (C) Ga-68 DOTA-TOC PET/CT imaging of patient 13 prior to and after two and three cycles of SSTR2-guided peptide receptor radionuclide therapy (PRRT) and F-18-SiFA-TATE PET/CT imaging of patient 34 prior to and after two cycles of PRRT. After two to three cycles of PRRT, Ga-DOTA-TOC PET/CT of patient 13 showed a significant decrease of tumor burden. Patient 13 also had a strong biochemical therapy response with a near normalization of plasma free normetanephrines (239 ng/L) from initial values of 1020 ng/L. In contrast, F-18-SiFA-TATE PET/CT of patient 34 showed slightly progressive disease after two cycles of PRRT.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
PCC patient 34
Primarily metastatic patient 34 also showed SSTR2-positivity in clinical imaging but, in contrast to patient 13, very low SSTR2 protein levels in Western blot analysis (Fig. 3A). Due to multiple lymph node and bone metastases, patient 34 received two cycles of PRRT after primary tumor resection but showed no radiological response with instead mildly progressive disease (Fig. 3C).
Drug treatment of patient primary cultures
We correlated drug responsivity with the underlying mutation/cluster affiliation, performed Western blot analysis where sufficient cell material was available (n = 16), and identified baseline and therapy-induced differences. Table 2 shows drug responsivity of the PPGL primary cultures, defined as the mean percentage of cell viability reduction after drug treatment, stratified depending on the underlying mutation and cluster affiliation. Statistical significance was assessed overall and for cluster 1, cluster 2, and metastatic primary cultures. We also compared drug responsivity of cluster 1-related with drug responsivity of cluster 2-related tumors.
Reduction in mean cell viabilitya following individual treatment according to the underlying mutation/cluster affiliation.
| Drug | Mean cell viability reduction in totalb[%] (n) ± s.d. | Mean cell viability reduction in cluster 1 tumorsb (%) (n) ± s.d. | Mean cell viability reduction in cluster 2 tumorsb (%) (n) ± s.d. | Mean cell viability reduction in metastatic tumorsb [%] (n) ± s.d. | |||||
|---|---|---|---|---|---|---|---|---|---|
| Total (n) | SDHB-mutant | VHL-mutant | Total (n) | RET-mutant | NF1-mutant | ||||
| Kinase signaling inhibitors | Cabozantinib (5 µM) | 39c (29) ± 0.19 | 44c† (8) ± 0.16 | 55 (3) ± 0.08 | 33 (4) ± 0.15 | 35c (13) ± 0.21 | 22 (4) ± 0.22 | 37 (6) ± 0.18 | 47c (7) ± 0.13 |
| Everolimus (10 nM) | 28c (31) ± 0.15 | 29c (9) ± 0.13 | 36 (4) ± 0.13 | 25 (4) ± 0.11 | 29c (13) ± 0.16 | 23 (4) ± 0.12 | 28 (6) ± 0.19 | 31c (7) ± 0.14 | |
| Sunitinib (0.5 µM) | 15c (30) ± 0.12 | 18c (8) ± 0.12 | 20 (3) ± 0.13 | 17 (4) ± 0.12 | 14c (13) ± 0.11 | 15 (4) ± 0.11 | 12 (6) ± 0.13 | 15c (6) ± 0.13 | |
| Cabozantinib (5 µM)/ Everolimus (10 nM) | 66c (14) ± 0.11 | 62c (5) ± 0.08 | 67 (2) ± 0.04 | 60 (2) ± 0.1 | 74c† (5) ± 0.13 | 60 (1) ± 0.03 | 82 (2) ± 0.09 | 62c (5) ± 0.07 | |
| Sunitinib (0.5 µM)/ Everolimus (10 nM) | 39c (26) ± 0.15 | 36c (7) ± 0.08 | 42 (2) ± 0.04 | 33 (4) ± 0.07 | 43c† (11) ± 0.17 | 36 (4) ± 0.12 | 47 (5) ± 0.21 | 38c (6) ± 0.12 | |
| Alpelisib (5 µM) | 34c (31) ± 0.12 | 34c (9) ± 0.11 | 34 (4) ± 0.09 | 36 (4) ± 0.12 | 33c (13) ± 0.12 | 30 (4) ± 0.15 | 29 (6) ± 0.08 | 33c (7) ± 0.09 | |
| Alpelisib (5 µM)/ Everolimus (10 nM) | 55c (31) ± 0.15 | 54c (9) ± 0.13 | 60 (4) ± 0.14 | 51 (4) ± 0.11 | 58c (13) ± 0.16 | 49 (4) ± 0.13 | 60 (6) ± 0.18 | 56c (7) ± 0.12 | |
| Trametinib (1 µM) | 29c (25) ± 0.19 | 34c (7) ± 0.11 | 36 (3) ± 0.06 | 28 (3) ± 0.12 | 27c (11) ± 0.23 | 21 (4) ± 0.14 | 26 (5) ± 0.3 | 31c (6) ± 0.11 | |
| Trametinib (1 µM)/ Alpelisib (5 µM) | 65c (18) ± 0.15 | 63c (7) ± 0.09 | 71 (3) ± 0.07 | 56 (3) ± 0.06 | 65c† (6) ± 0.23 | 57 (1) ± 0.03 | 60 (3) ± 0.31 | 65c (5) ± 0.07 | |
| Dabrafenib (10 µM) | Increase by 16+ (20) ± 0.25 | Increase by 12+ (6) ± 0.12 | Increase by 19 (2) ± 0.07 | Increase by 10 (3) ± 0.14 | Increase by 13 (8) ± 0.32 | Increase by 9 (4) ± 0.38 | Increase by 12 (3) ± 0.24 | Increase by 23 (6) ± 0.23 | |
| Trametinib (1 µM)/ Dabrafenib (10 µM) | 22c (17) ± 0.14 | 21c (6) ± 0.09 | 19 (2) ± 0.08 | 20 (3) ± 0.11 | 22c (6) ± 0.14 | 15 (2) ± 0.09 | 25 (3) ± 0.18 | 22 (5) ± 0.17 | |
| Selpercatinib (5 µM) AR-A014418 (20 µM) |
33c (22) ± 0.16 50c (15) ± 0.19 |
41c† (6) ± 0.13 49c (6) ± 0.19 |
46 (3) ± 0.1356 (4) ± 0.17 | 37 (2) ± 0.0922 (1) ± 0.04 | 28c (9) ± 0.13 50c (6) ± 0.21 |
20 (3) ± 0.159 (1) ± 0.03 | 31 (4) ± 0.1456 (3) ± 0.13 | 37c (6) ± 0.12 49c (5) ± 0.17 |
|
| Chemotherapeutics, HIF-2a Inhibitors, SSTR2 Analogues | Temozolomide (100 µM) | 2 (19) ± 0.2 | 3 (5) ± 0.11 | 4 (2) ± 0.11 | 2 (2) ± 0.13 | 6 (8) ± 0.18 | 0 (1) ± 0.12 | 4 (5) ± 0.21 | 2 (5) ± 0.1 |
| Niraparib (10 µM) | 27c (27) ± 0.19 | 30 (7) ± 0.1 | 37 (2) ± 0.1 | 28 (4) ± 0.09 | 23c (12) ± 0.24 | 12 (4) ± 0.16 | 27 (5) ± 0.33 | 35c (6) ± 0.13 | |
| Temozolomide (100 µM)/Niraparib (10 µM) | 37c (19) ± 0.14 | 41 (5) ± 0.13 | 52 (2) ± 0.07 | 35 (2) ± 0.11 | 36c (8) ± 0.17 | 20 (1) ± 0.04 | 39 (5) ± 0.19 | 41 (5) ± 0.12 | |
| Entinostat (1 µM) Niraparib (10 µM)/ Entinostat (1 µM) |
40c (28) ± 0.18 46c (23) ± 0.16 |
44 (7) ± 0.1444 (6) ± 0.11 | 45 (3) ± 0.1552 (3) ± 0.07 | 44 (4) ± 0.1540 (3) ± 0.11 | 38c (13) ± 0.2 46c (10) ± 0.18 |
36 (4) ± 0.1645 (4) ± 0.17 | 34 (6) ± 0.2338 (3) ± 0.22 | 42c (6) ± 0.12 53c (6) ± 0.09 |
|
| Gemcitabine (30 µM) | 47c (14) ± 0.2 | 52c (5) ± 0.19 | 60 (3) ± 0.19 | 30 (1) ± 0.05 | 49c (6) ± 0.21 | 45 (1) ± 0.07 | 58 (2) ± 0.27 | 51c (4) ± 0.23 | |
| Gemcitabine (30 µM)/ AR-A014418 (20 µM) | 54c (13) ± 0.19 | 52c (5) ± 0.2 | 62 (3) ± 0.18 | 25 (1) ± 0.02 | 55c (5) ± 0.21 | 65 (1) ± 0.09 | 55 (2) ± 0.14 | 62c (4) ± 0.13 | |
| 5-fluorouracile (20 µM) | 27c (21) ± 0.23 | 36c† (6) ± 0.11 | 40 (3) ± 0.08 | 29 (2) ± 0.14 | 20c (8) ± 0.3 | Increase by 4 (3) ± 0.29 | 35 (3) ± 0.27 | 34c (6) ± 0.13 | |
| TCS-7009 (20 µM) | 8c (17) ± 0.15 | 9c (5) ± 0.1 | 9 (1) ± 0.07 | 8 (4) ± 0.11 | 8 (7) ± 0.2 | Increase by 1 (3) ± 0.21 | 7 (2) ± 0.19 | 9 (4) ± 0.14 | |
| TCS-7009 (40 µM) | 19c (17) ± 0.18 | 18c (5) ± 0.17 | 15 (1) ± 0.07 | 18 (4) ± 0.18 | 22c (7) ± 0.19 | 13 (3) ± 0.16 | 21 (2) ± 0.21 | 17c (4) ± 0.18 | |
| Belzutifan (10 µM) | 1 (8) ± 0.14 | Increase by 2 (2) ± 0.18 | Increase by 2 (2) ± 0.18 |
- | 1 (4) ± 0.13 | Increase by 2 (1) ± 0.04 | 1 (2) ± 0.18 | 1 (3) ± 0.16 | |
| Belzutifan (20 µM) | 7 (9) ± 0.11 | 5 (3) ± 0.14 | 5 (2) ± 0.15 | - | 6 (4) ± 0.1 | 12 (1) ± 0.08 | 7 (2) ± 0.1 | 7 (3) ± 0.12 | |
| Octreotide (40 µM) | 2 (19) ± 0.13 | 3 (6) ± 0.13 | 7 (3) ± 0.13 | Increase by 1 (2) ± 0.1 | 2 (7) ± 0.15 | 7 (2) ± 0.19 | 3 (3) ± 0.16 | 2 (5) ± 0.08 | |
| Others | Zoledronic acid (5 µM) | 26c (20) ± 0.2 | 21c (6) ± 0.2 | 35 (3) ± 0.19 | 7 (2) ± 0.05 | 32c† (8) ± 0.21 | 19 (2) ± 0.07 | 38 (4) ± 0.28 | 29c (5) ± 0.2 |
| Zoledronic acid (40 µM) | 45* (18) ± 0.22 | 50* (5) ± 0.22 | 64 (3) ± 0.11 | 38 (1) ± 0.03 | 46* (8) ± 0.25 | 31 (2) ± 0.07 | 49 (4) ± 0.32 | 53* (5) ± 0.18 | |
| Estradiol (1 µM) | 10* (12) ± 0.15 | 4 (4) ± 0.12 | 5 (3) ± 0.14 | - | 12* (5) ± 0.15 | 4 (1) ± 0.1 | 25 (2) ± 0.13 | 1 (4) ± 0.1 | |
| Estradiol (10 µM) | 26* (12) ± 0.18 | 16* (4) ± 0.2 | 23 (3) ± 0.17 | - | 28*† (5) ± 0.09 | 29 (1) ± 0.01 | 25 (2) ± 0.12 | 23* (4) ± 0.15 | |
aEfficacy is described as poor (<25% cell viability reduction), moderate (25–50% cell viability reduction), and strong (>50% cell viability reduction). bStatistical significance was assessed for total primary cultures, total cluster 1 tumors, total cluster 2 tumors and metastatic tumors. Significance could not be assessed for temozolomide, niraparib, entinostat, temozolomide/niraparib, niraparib/entinostat in cluster 1. Significance could not be assessed for dabrafenib, trametinib/dabrafenib, temozolomide, temozolomide/niraparib in metastatic tumors. cSignificant decrease of cell viability compared to control DMSO P < 0.05. +Significant increase of cell viability compared to control DMSO P < 0.05. †Significantly higher efficacy of the listed therapy in the marked cluster compared to the other cluster.
Kinase signaling inhibitors in clinical use: targeting cluster 2?
Multi-TKIs cabozantinib and sunitinib alone and in combination with mTORC1 inhibitor everolimus
Cabozantinib and sunitinib are currently in clinical use as therapeutic options for progressive metastatic PPGLs. In our PPGL primary cultures, we tested both drugs alone and in combination with everolimus, which is clinically used for progressive neuroendocrine tumors (NETs). Clinically relevant doses of cabozantinib (5 µM), sunitinib (0.5 µM), and everolimus (10 nM) significantly reduced primary culture cell viability. Cabozantinib showed the strongest efficacy. Unexpectedly, cabozantinib was significantly more effective in cluster 1- (n = 8) compared to cluster 2-related PPGLs (n = 13) (−44% vs −35% viability reduction), especially in SDHB-mutant metastatic PPGLs (−55%, n = 3) (Fig. 4A). Everolimus was similarly effective in both clusters (-28%, n = 31) but showed stronger efficacy in SDHB-mutant PPGLs (−36%, n = 4).
The tyrosine kinase inhibitor (TKI) cabozantinib tested in combination with the mTORC1 inhibitor everolimus in 2D PPGL primary cultures and in MPC cell spheroids. (A) Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with cabozantinib (n = 29) alone and in combination with everolimus (n = 31). Cabozantinib at a dose close to the clinically relevant doses significantly reduced cell viability, particularly in the SDHB-mutant metastatic tumors of patients 36, 37, and 49 (red frame). Cabozantinib/everolimus combination therapy led to an overall synergistic decrease of cell viability (n = 14). An additive decrease was found in cluster 1-related (n = 5) and metastatic tumors (n = 5) while a synergistic decrease was found in cluster 2-related tumors (n = 5). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Combination treatment with cabozantinib and everolimus in MPC cell spheroids with expression of Hif2α resulted in a significant reduction in spheroid diameter and showed superiority to treatment with cabozantinib alone. (C) Cabozantinib/everolimus significantly reduced the spheroid diameter, compared to the untreated controls, with slightly higher efficacy in Sdhb knockdown spheroids compared to the control spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01 vs MPCmCherry EV or MPC Cas9 ctrl #P < 0.05, ##P < 0.01, vs cabozantinib alone $P < 0.05, $$P < 0.01. (D) Cabozantinib/everolimus combination treatment significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the untreated DMSO control or single treatment with cabozantinib.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
The tyrosine kinase inhibitor (TKI) cabozantinib tested in combination with the mTORC1 inhibitor everolimus in 2D PPGL primary cultures and in MPC cell spheroids. (A) Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with cabozantinib (n = 29) alone and in combination with everolimus (n = 31). Cabozantinib at a dose close to the clinically relevant doses significantly reduced cell viability, particularly in the SDHB-mutant metastatic tumors of patients 36, 37, and 49 (red frame). Cabozantinib/everolimus combination therapy led to an overall synergistic decrease of cell viability (n = 14). An additive decrease was found in cluster 1-related (n = 5) and metastatic tumors (n = 5) while a synergistic decrease was found in cluster 2-related tumors (n = 5). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Combination treatment with cabozantinib and everolimus in MPC cell spheroids with expression of Hif2α resulted in a significant reduction in spheroid diameter and showed superiority to treatment with cabozantinib alone. (C) Cabozantinib/everolimus significantly reduced the spheroid diameter, compared to the untreated controls, with slightly higher efficacy in Sdhb knockdown spheroids compared to the control spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01 vs MPCmCherry EV or MPC Cas9 ctrl #P < 0.05, ##P < 0.01, vs cabozantinib alone $P < 0.05, $$P < 0.01. (D) Cabozantinib/everolimus combination treatment significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the untreated DMSO control or single treatment with cabozantinib.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
The tyrosine kinase inhibitor (TKI) cabozantinib tested in combination with the mTORC1 inhibitor everolimus in 2D PPGL primary cultures and in MPC cell spheroids. (A) Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with cabozantinib (n = 29) alone and in combination with everolimus (n = 31). Cabozantinib at a dose close to the clinically relevant doses significantly reduced cell viability, particularly in the SDHB-mutant metastatic tumors of patients 36, 37, and 49 (red frame). Cabozantinib/everolimus combination therapy led to an overall synergistic decrease of cell viability (n = 14). An additive decrease was found in cluster 1-related (n = 5) and metastatic tumors (n = 5) while a synergistic decrease was found in cluster 2-related tumors (n = 5). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Combination treatment with cabozantinib and everolimus in MPC cell spheroids with expression of Hif2α resulted in a significant reduction in spheroid diameter and showed superiority to treatment with cabozantinib alone. (C) Cabozantinib/everolimus significantly reduced the spheroid diameter, compared to the untreated controls, with slightly higher efficacy in Sdhb knockdown spheroids compared to the control spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01 vs MPCmCherry EV or MPC Cas9 ctrl #P < 0.05, ##P < 0.01, vs cabozantinib alone $P < 0.05, $$P < 0.01. (D) Cabozantinib/everolimus combination treatment significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the untreated DMSO control or single treatment with cabozantinib.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Cabozantinib/everolimus combination treatment was highly effective in both clusters and showed an overall synergistic effect (−66%, n = 14) with slightly but significantly stronger efficacy in cluster 2 (−74%, n = 5) compared to cluster 1 (−62%, n = 5; Fig. 4A). Combination treatment resulted in attenuation of everolimus-induced AKT activation and a strong inhibition of mTOR downstream effectors 4EBP1, p70S6K, and S6 (n = 6) as a potential explanation for the synergism of the two drugs (Supplementary Fig. 2). Supporting this finding, we confirmed the strong efficacy of cabozantinib/everolimus combination treatment in a MPC spheroid model, with significant spheroid shrinkage and no regrowth 10 days after combination treatment (Fig. 4B, C and D).
Sunitinib showed low overall efficacy (−15%, n = 30) with best efficacy in SDHB-mutant tumors (−20%, n = 3) (Fig. 5). Sunitinib/everolimus combination treatment was significantly more effective in cluster 2 (−43%, n = 11) compared to cluster 1 (−36%, n = 7) and showed additive effects (Fig. 5). However, the efficacy of sunitinib/everolimus was overall much weaker compared to other targeted combinations tested (cabozantinib/everolimus, alpelisib/everolimus, alpelisib/trametinib (see below)), especially in metastatic SDHB-mutant primary cultures 36 and 37 (Figs 4, 5 and 6, red-labeled).
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with the tyrosine kinase inhibitor (TKI) sunitinib (n = 30) alone and in combination with the mTORC1 inhibitor everolimus (n = 31). Sunitinib/everolimus combination therapy (n = 26) led to an additive but weaker decrease of cell viability compared to other targeted combination therapies, especially in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). An additive decrease of cell viability was also found in cluster 2-related (n = 11) and metastatic (n = 6) tumors. However, in cluster 1-related (n = 7) tumors, sunitinib/everolimus showed antagonistic effects. *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with the tyrosine kinase inhibitor (TKI) sunitinib (n = 30) alone and in combination with the mTORC1 inhibitor everolimus (n = 31). Sunitinib/everolimus combination therapy (n = 26) led to an additive but weaker decrease of cell viability compared to other targeted combination therapies, especially in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). An additive decrease of cell viability was also found in cluster 2-related (n = 11) and metastatic (n = 6) tumors. However, in cluster 1-related (n = 7) tumors, sunitinib/everolimus showed antagonistic effects. *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay: Treatment with the tyrosine kinase inhibitor (TKI) sunitinib (n = 30) alone and in combination with the mTORC1 inhibitor everolimus (n = 31). Sunitinib/everolimus combination therapy (n = 26) led to an additive but weaker decrease of cell viability compared to other targeted combination therapies, especially in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). An additive decrease of cell viability was also found in cluster 2-related (n = 11) and metastatic (n = 6) tumors. However, in cluster 1-related (n = 7) tumors, sunitinib/everolimus showed antagonistic effects. *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay of the PI3K inhibitor alpelisib (n = 31) and the mTORC1 inhibitor everolimus (n = 31). Additive decrease of overall cell viability by alpelisib/everolimus combination therapy (n = 31) as well as in cluster 1-related (n = 9) and metastatic tumors (n = 7). Synergistic decrease of cell viability by alpelisib/everolimus combination therapy in cluster 2-related tumors (n = 13). Notably, the highest viability decrease was found in metastatic SDHB-mutant primary cultures 36, 37, and 48 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay of the PI3K inhibitor alpelisib (n = 31) and the mTORC1 inhibitor everolimus (n = 31). Additive decrease of overall cell viability by alpelisib/everolimus combination therapy (n = 31) as well as in cluster 1-related (n = 9) and metastatic tumors (n = 7). Synergistic decrease of cell viability by alpelisib/everolimus combination therapy in cluster 2-related tumors (n = 13). Notably, the highest viability decrease was found in metastatic SDHB-mutant primary cultures 36, 37, and 48 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Stratification depending on molecular clusters and malignancy. Patients with the same mutation are represented by the same color. Seventy-two-hour cell viability assay of the PI3K inhibitor alpelisib (n = 31) and the mTORC1 inhibitor everolimus (n = 31). Additive decrease of overall cell viability by alpelisib/everolimus combination therapy (n = 31) as well as in cluster 1-related (n = 9) and metastatic tumors (n = 7). Synergistic decrease of cell viability by alpelisib/everolimus combination therapy in cluster 2-related tumors (n = 13). Notably, the highest viability decrease was found in metastatic SDHB-mutant primary cultures 36, 37, and 48 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
PI3K inhibitor alpelisib alone and in combination with everolimus
We have previously shown synergistic effects of alpelisib in combination with everolimus in a few patients’ primary cultures (n = 6) and in human progenitor pheochromocytoma (hPheo1) cells (Fankhauser et al. 2019, Helm et al. 2022). We have now extended these investigations by analyzing cluster-specific drug responsivity in a larger cohort (n = 31).
Clinically relevant doses of alpelisib (5 µM) led to a similar cell viability decrease in both clusters (−34% and −33%, respectively). Alpelisib/everolimus combination therapy showed strong efficacy (−55%) with an additive effect overall and in cluster 1 (−54%, n = 9) but a synergistic effect in cluster 2 (−58%, n = 13; Fig. 6). Notably, the strongest decrease in viability was found in metastatic SDHB-mutant tumors (−64%, n = 3). We cross-validated the efficacy of alpelisib/everolimus in three out of four 3D primary cultures. One of those was cluster 1-related (VHL-mutant), one was cluster 2-related (TMEM127-mutant), and one was metastatic (ATRX-mutant) (Fig. 7). Alpelisib/everolimus combination treatment attenuated everolimus-induced AKT activation and strongly inhibited 4EBP1, p70S6K, and S6 signaling (n = 16) (Supplementary Fig. 3).
Three dimensional PPGL primary cultures (n = 4). Significant decrease of cell viability compared to the control was achieved by PI3K inhibitor alpelisib (n = 4) and RET inhibitor selpercatinib (n = 3) monotherapies, but mTORC1 inhibitor everolimus monotherapy significantly decreased cell viability in only 1/4 3D primary cultures (patient 30). Alpelisib/everolimus combination therapy led to a highly significant decrease of cell viability in 3/4 3D primary cultures – one cluster 1-related (VHL-mutant), one cluster 2-related (TMEM127-mutant), and one metastatic (ATRX-mutant). Significant decrease of cell viability compared to the untreated control: *P ≤ 0.05, **P≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Three dimensional PPGL primary cultures (n = 4). Significant decrease of cell viability compared to the control was achieved by PI3K inhibitor alpelisib (n = 4) and RET inhibitor selpercatinib (n = 3) monotherapies, but mTORC1 inhibitor everolimus monotherapy significantly decreased cell viability in only 1/4 3D primary cultures (patient 30). Alpelisib/everolimus combination therapy led to a highly significant decrease of cell viability in 3/4 3D primary cultures – one cluster 1-related (VHL-mutant), one cluster 2-related (TMEM127-mutant), and one metastatic (ATRX-mutant). Significant decrease of cell viability compared to the untreated control: *P ≤ 0.05, **P≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Three dimensional PPGL primary cultures (n = 4). Significant decrease of cell viability compared to the control was achieved by PI3K inhibitor alpelisib (n = 4) and RET inhibitor selpercatinib (n = 3) monotherapies, but mTORC1 inhibitor everolimus monotherapy significantly decreased cell viability in only 1/4 3D primary cultures (patient 30). Alpelisib/everolimus combination therapy led to a highly significant decrease of cell viability in 3/4 3D primary cultures – one cluster 1-related (VHL-mutant), one cluster 2-related (TMEM127-mutant), and one metastatic (ATRX-mutant). Significant decrease of cell viability compared to the untreated control: *P ≤ 0.05, **P≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Alpelisib in combination with MEK inhibitor trametinib
We evaluated the combination of trametinib, which is in clinical use for metastatic melanoma, with alpelisib. Trametinib (1 µM) showed a moderate overall viability decrease (−29%, n = 25), with a slightly higher efficacy in cluster 1 than cluster 2 (−34%, n = 7 and −27%, n = 11). Trametinib/alpelisib combination resulted in an overall synergistic cell viability decrease in both clusters (−65%, n =18), with strongest efficacy in SDHB-mutant PPGLs (−71%, n = 3), and significantly stronger efficacy in cluster 2 compared to cluster 1 (Fig. 8A).
Seventy-two-hour cell viability assay, 24-h Western blot analysis and Western blot quantification after treatment with the PI3K inhibitor alpelisib and the MEK inhibitor trametinib. (A) Patients with the same mutation are represented by the same color. Significant decrease of cell viability by alpelisib (n = 31), trametinib (n = 25) and the combination of alpelisib and trametinib (n = 18) compared to control DMSO *P < 0.05. Alpelisib/trametinib combination showed an overall synergistic effect in clinically relevant doses. (B) Representative western blot of metastatic PCC patient 27: Alpelisib/trametinib combination therapy led to an attenuation of trametinib-induced AKT activation. Trametinib and the alpelisib/trametinib combination also inhibited ERK and strongly activated MEK. (C) Western blot quantification of phosphorylated AKT, ERK, and MEK of primary cultures tested with trametinib and alpelisib (n = 2).
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Seventy-two-hour cell viability assay, 24-h Western blot analysis and Western blot quantification after treatment with the PI3K inhibitor alpelisib and the MEK inhibitor trametinib. (A) Patients with the same mutation are represented by the same color. Significant decrease of cell viability by alpelisib (n = 31), trametinib (n = 25) and the combination of alpelisib and trametinib (n = 18) compared to control DMSO *P < 0.05. Alpelisib/trametinib combination showed an overall synergistic effect in clinically relevant doses. (B) Representative western blot of metastatic PCC patient 27: Alpelisib/trametinib combination therapy led to an attenuation of trametinib-induced AKT activation. Trametinib and the alpelisib/trametinib combination also inhibited ERK and strongly activated MEK. (C) Western blot quantification of phosphorylated AKT, ERK, and MEK of primary cultures tested with trametinib and alpelisib (n = 2).
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Seventy-two-hour cell viability assay, 24-h Western blot analysis and Western blot quantification after treatment with the PI3K inhibitor alpelisib and the MEK inhibitor trametinib. (A) Patients with the same mutation are represented by the same color. Significant decrease of cell viability by alpelisib (n = 31), trametinib (n = 25) and the combination of alpelisib and trametinib (n = 18) compared to control DMSO *P < 0.05. Alpelisib/trametinib combination showed an overall synergistic effect in clinically relevant doses. (B) Representative western blot of metastatic PCC patient 27: Alpelisib/trametinib combination therapy led to an attenuation of trametinib-induced AKT activation. Trametinib and the alpelisib/trametinib combination also inhibited ERK and strongly activated MEK. (C) Western blot quantification of phosphorylated AKT, ERK, and MEK of primary cultures tested with trametinib and alpelisib (n = 2).
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
This synergism may be explained by alpelisib-mediated attenuation of trametinib-induced AKT activation and simultaneous trametinib-mediated inhibition of ERK (n = 2) (Fig. 8B and C). Unexpectedly, trametinib alone and in combination with alpelisib led to strong increases of phosphorylated MEK (pMEK), possibly be due to feedback induction of upstream signaling (Yaeger & Corcoran 2019).
Trametinib in combination with the RAF inhibitor dabrafenib
In contrast to trametinib, dabrafenib (10 µM) significantly promoted overall cell survival (+16%, n = 20), especially in metastatic PPGLs (+23%, n = 6; Fig. 9A), possibly through increased activation of ERK (n = 6; Fig. 9B). Dabrafenib/trametinib combination treatment led to a weaker decrease of cell viability than trametinib alone (−22%, n = 17 vs −29%, n = 25).
Seventy-two-hour cell viability assays and 24-h Western blots of the RAF inhibitor dabrafenib, the MEK inhibitor trametinib and the RET inhibitor selpercatinib. (A) Patients with the same mutation are represented by the same color. Dabrafenib in combination with trametinib had opposite effects on cell viability (n = 17): While trametinib significantly decreased cell viability (n = 25), dabrafenib significantly promoted PPGL primary culture survival (n = 20). Selpercatinib also significantly decreased cell viability in concentrations of 120 μM (n = 22). *Significant decrease of cell viability compared to control DMSO P < 0.05, +significant increase of cell viability compared to control DMSO P < 0.05. (B) Representative Western blots of PCC patient 18 and abdominal PGL patient 21: While trametinib strongly inhibited ERK and effectively decreased tumor cell survival, dabrafenib induced paradoxical ERK activations in most PPGL primary cultures which may explain its lack of efficacy and its beneficial effect on tumor survival. Selpercatinib inhibited ERK in the primary culture of patient 18 with a high-risk RET mutation but not in the primary culture of patient 21.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Seventy-two-hour cell viability assays and 24-h Western blots of the RAF inhibitor dabrafenib, the MEK inhibitor trametinib and the RET inhibitor selpercatinib. (A) Patients with the same mutation are represented by the same color. Dabrafenib in combination with trametinib had opposite effects on cell viability (n = 17): While trametinib significantly decreased cell viability (n = 25), dabrafenib significantly promoted PPGL primary culture survival (n = 20). Selpercatinib also significantly decreased cell viability in concentrations of 120 μM (n = 22). *Significant decrease of cell viability compared to control DMSO P < 0.05, +significant increase of cell viability compared to control DMSO P < 0.05. (B) Representative Western blots of PCC patient 18 and abdominal PGL patient 21: While trametinib strongly inhibited ERK and effectively decreased tumor cell survival, dabrafenib induced paradoxical ERK activations in most PPGL primary cultures which may explain its lack of efficacy and its beneficial effect on tumor survival. Selpercatinib inhibited ERK in the primary culture of patient 18 with a high-risk RET mutation but not in the primary culture of patient 21.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Seventy-two-hour cell viability assays and 24-h Western blots of the RAF inhibitor dabrafenib, the MEK inhibitor trametinib and the RET inhibitor selpercatinib. (A) Patients with the same mutation are represented by the same color. Dabrafenib in combination with trametinib had opposite effects on cell viability (n = 17): While trametinib significantly decreased cell viability (n = 25), dabrafenib significantly promoted PPGL primary culture survival (n = 20). Selpercatinib also significantly decreased cell viability in concentrations of 120 μM (n = 22). *Significant decrease of cell viability compared to control DMSO P < 0.05, +significant increase of cell viability compared to control DMSO P < 0.05. (B) Representative Western blots of PCC patient 18 and abdominal PGL patient 21: While trametinib strongly inhibited ERK and effectively decreased tumor cell survival, dabrafenib induced paradoxical ERK activations in most PPGL primary cultures which may explain its lack of efficacy and its beneficial effect on tumor survival. Selpercatinib inhibited ERK in the primary culture of patient 18 with a high-risk RET mutation but not in the primary culture of patient 21.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Selective RET inhibitor selpercatinib
Clinically relevant doses of selpercatinib (5 µM) showed overall moderate efficacy with significantly higher efficacy in cluster 1-related (n = 6) and slightly higher efficacy in metastatic, compared to cluster 2-related primary cultures (n = 9) (−41%, −37%, and −28%, respectively), including RET-mutant patients (−20%, n = 3). Selpercatinib inhibited ERK signaling in most (9/12) PPGL primary cultures, including RET-mutant PCC from patient 18 (Fig. 9B).
Chemotherapeutics, inhibitors of PARP, HDAC1 and HIF-2a, somatostatin analogs: targeting cluster 1?
Chemotherapeutic temozolomide, PARP inhibitor niraparib, and HDAC1 inhibitor entinostat
As previously published (n = 5) (Fankhauser et al. 2019), temozolomide (100 µM) – currently in clinical use for metastatic PPGLs – showed poor overall efficacy in human primary cultures (−2%, n = 19). Niraparib (10 µM) and entinostat (1 µM) were moderately effective (−27%, n = 27 and −40%, n = 28) with slightly higher efficacy in cluster 1 and metastatic PPGLs, compared to cluster 2. Temozolomide/niraparib combination therapy showed overall synergistic effects (−37%, n = 19) while niraparib/entinostat combination therapy showed antagonistic effects (−46%, n = 23), with no relevant difference between both clusters. Both combination therapies showed strong efficacy in SDHB-mutant PPGLs (−52%, n = 2 and −52%, n = 3).
Chemotherapeutic gemcitabine alone and in combination with GSK3 inhibitor AR-A014418
Clinically relevant doses of gemcitabine (30 µM) led to a moderate viability decrease (−47%, n = 14) in both clusters, with strong efficacy in SDHB-mutant cases (−60% n = 3, −72% in two metastatic SDHB-mutant cases; Fig. 10A). MPC spheroid models confirmed the strong efficacy of gemcitabine with a strong shrinkage/destruction of all cell line spheroids and no regrowth 10 days after treatment (Sdhb knockdown and control cells; Fig. 10B and C). Since GSK3 inhibition may sensitize cancer cells to chemotherapy with gemcitabine, we tested the GSK3 inhibitor AR-A014418 in combination with gemcitabine. However, while AR-A014418 (20 µM) alone significantly decreased overall cell viability (−50%, n = 15), gemcitabine/AR-A014418 combination therapy showed antagonistic effects (−54%, n = 13).
The chemotherapeutic agent (CTX) gemcitabine alone and in combination with the GSK3 inhibitor AR-A014418, and the antiresorptive agent zoledronic acid: 72-h cell viability assays. Patients with the same mutation are represented by the same color. (A) The combination of AR-A01441 and gemcitabine showed antagonistic effects in the PPGL primary cultures (n = 13). Clinically relevant doses of gemcitabine significantly decreased cell viability in all PPGL primary cultures tested (n = 14) but particularly in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Single treatment with gemcitabine significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the DMSO control. (C) Gemcitabine showed high efficacy to reduce the diameter of MPC Sdhb knockdown spheroids at both concentrations tested. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control **P < 0.01. (D) Zoledronic acid also significantly decreased cell viability at concentrations of 5–40 µM (n = 18–20) and especially in the SDHB-mutant primary cultures of patients 36, 37, and 47 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (E) Single treatment with zoledronic acid significantly reduced the diameter of MPC Sdhb knockdown spheroids compared to the DMSO control. (F) Zoledronic acid showed increased efficacy to reduce diameter of MPC Sdhb knockdown spheroids compared with MPC Cas9 crtl spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01, vs MPC Cas9 ctrl # P < 0.05, ##P < 0.01, vs zoledronic acid 5 µM $P < 0.05, $$P < 0.01.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
The chemotherapeutic agent (CTX) gemcitabine alone and in combination with the GSK3 inhibitor AR-A014418, and the antiresorptive agent zoledronic acid: 72-h cell viability assays. Patients with the same mutation are represented by the same color. (A) The combination of AR-A01441 and gemcitabine showed antagonistic effects in the PPGL primary cultures (n = 13). Clinically relevant doses of gemcitabine significantly decreased cell viability in all PPGL primary cultures tested (n = 14) but particularly in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Single treatment with gemcitabine significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the DMSO control. (C) Gemcitabine showed high efficacy to reduce the diameter of MPC Sdhb knockdown spheroids at both concentrations tested. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control **P < 0.01. (D) Zoledronic acid also significantly decreased cell viability at concentrations of 5–40 µM (n = 18–20) and especially in the SDHB-mutant primary cultures of patients 36, 37, and 47 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (E) Single treatment with zoledronic acid significantly reduced the diameter of MPC Sdhb knockdown spheroids compared to the DMSO control. (F) Zoledronic acid showed increased efficacy to reduce diameter of MPC Sdhb knockdown spheroids compared with MPC Cas9 crtl spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01, vs MPC Cas9 ctrl # P < 0.05, ##P < 0.01, vs zoledronic acid 5 µM $P < 0.05, $$P < 0.01.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
The chemotherapeutic agent (CTX) gemcitabine alone and in combination with the GSK3 inhibitor AR-A014418, and the antiresorptive agent zoledronic acid: 72-h cell viability assays. Patients with the same mutation are represented by the same color. (A) The combination of AR-A01441 and gemcitabine showed antagonistic effects in the PPGL primary cultures (n = 13). Clinically relevant doses of gemcitabine significantly decreased cell viability in all PPGL primary cultures tested (n = 14) but particularly in the metastatic SDHB-mutant primary cultures 36 and 37 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (B) Single treatment with gemcitabine significantly diminished the growth of MPC Sdhb knockdown spheroids compared to the DMSO control. (C) Gemcitabine showed high efficacy to reduce the diameter of MPC Sdhb knockdown spheroids at both concentrations tested. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control **P < 0.01. (D) Zoledronic acid also significantly decreased cell viability at concentrations of 5–40 µM (n = 18–20) and especially in the SDHB-mutant primary cultures of patients 36, 37, and 47 (red frame). *Significant decrease of cell viability compared to control DMSO P < 0.05. (E) Single treatment with zoledronic acid significantly reduced the diameter of MPC Sdhb knockdown spheroids compared to the DMSO control. (F) Zoledronic acid showed increased efficacy to reduce diameter of MPC Sdhb knockdown spheroids compared with MPC Cas9 crtl spheroids. Mean ± s.e.m. ANOVA and Bonferroni post hoc test comparison vs DMSO control *P < 0.05, **P < 0.01, vs MPC Cas9 ctrl # P < 0.05, ##P < 0.01, vs zoledronic acid 5 µM $P < 0.05, $$P < 0.01.
Citation: Endocrine-Related Cancer 29, 6; 10.1530/ERC-21-0355
Chemotherapeutic 5-FU
5-FU (20 µM) moderately decreased cell viability in the primary cultures (−27%, n = 21). Significantly higher efficacy was detected in cluster 1-related (−36%, n = 6), with the highest efficacy in SDHB-mutant (−40%, n = 3), compared to cluster 2-related tumors (−20%, n = 8). In RET-mutant tumors, 5-FU treatment even led to a promotion of tumor cell survival (+4%, n = 3).
HIF-2a inhibitors
TC-S 7009 (20 µM, 40 µM, n = 17) and belzutifan (10 µM, 20 µM, n = 9) showed low overall efficacy in the primary cultures and no difference between both clusters (TC-S 7009: −8% (20 µM) and −19% (40 µM); belzutifan: −1% (10 µM) and −7% (20 µM)).
Somatostatin analog octreotide
Octreotide has been approved for the therapy of metastatic NETs but data on PPGLs is still lacking. Octreotide (40 µM) showed no efficacy in the primary cultures (−2%, n = 19) and no difference between clusters, including patients 13 and 21 with high SSTR2 expression.
Others
Bisphosphonate zoledronic acid
Zoledronic acid, which is regularly applied to PPGL patients with bone metastases, significantly decreased cell viability at clinically relevant (5 µM) (−26%, n = 20) and higher doses (40 µM) (−45%, n = 18). At low doses, efficacy was significantly higher in cluster 2 (−32%, n = 8; cluster 1: −21%, n = 6), while high doses were slightly more effective in cluster 1 and metastatic PPGLs (−50%, n = 5 and −53%, n = 5; cluster 2: 46%, n = 8; Fig. 10D). The highest efficacy was found in SDHB-mutant PPGLs (−64%, n = 3). In MPC spheroids, we found an approximately 1.5-fold decrease of spheroid diameter 10 days after treatment with high-dose zoledronic acid and no regrowth, but no significant difference between Sdhb knockdown and control cells (Fig. 10E and F).
Estrogen
In order to assess the reason for potential sex differences with regards to PPGL growth, we investigated estrogen in primary cultures. High-dose (10 µM) estradiol led to a significantly stronger cell viability reduction in cluster 2-related (−28%, n = 5), compared to cluster 1-related tumors (−16%, n = 4) and low-dose (1 µM) estradiol led to a slightly higher effect in cluster 2 (−12%, n = 5), compared to cluster 1 (−4%, n = 4).
Validation of primary culture data in MPC cells
In order to evaluate the effects of longer treatment times on tumor cell (re-)growth, we also performed MPC cell line experiments applying gemcitabine, cabozantinib/everolimus, alpelisib/trametinib, alpelisib/everolimus, and zoledronic acid with extended treatment times over 14 days (change of medium and drug treatment every 3 days; Supplementary Fig. 4). After long-term treatment (6, 10, and 14 days) with gemcitabine (30 µM), cabozantinib (5 µM), cabozantinib (5 µM)/everolimus (10 nM), alpelisib (5 µM), trametinib (1 µM), alpelisib (2.5 µM)/trametinib (1 µM), or alpelisib (5 µM)/everolimus (10 nM), almost no surviving MPC cells and no tumor cell regrowth were observed. For high-dose zoledronic acid (40 µM), there was also a strong significant cell viability reduction (to 15.5%) and no regrowth; however, there was no efficacy of low dose zoledronic acid (5 µM).
Discussion
There is a considerable clinical need for novel more optimal therapeutic strategies for metastatic PPGLs (Nölting et al. 2022). Given the lack of available human PPGL cell line models, we have established a method for multiple drug testing in patient-derived PPGL primary cultures (Fankhauser et al. 2019), which we have now expanded to a larger number of 33 PPGL primary cultures, including several metastatic tumors. This enables us for the first time to assess cluster-specific drug responsivities.
Consistent with other studies (Burnichon et al. 2011, Yao et al. 2011, 2016, Luchetti et al. 2015, Fishbein et al. 2017, Gieldon et al. 2019, Jiang et al. 2020), we could identify driver mutations in 79% of cases. Noradrenergic phenotypes correlated with cluster 1 mutations and adrenergic phenotypes with cluster 2 mutations, with only a few exceptions.
Kinase signaling inhibitors
Surprisingly, kinase signaling inhibitors – expected to be more effective in cluster 2-related tumors – showed similar efficacy in both clusters (sunitinib, everolimus, alpelisib, trametinib, and GSK3 inhibitor AR-A014418) or even stronger efficacy in cluster 1-related PPGLs (cabozantinib and selpercatinib).
We found strong efficacy of targeted combination treatments (cabozantinib/everolimus, alpelisib/everolimus, alpelisib/trametinib) in both clusters, with a slightly but significantly better responsivity of cluster 2 (cabozantinib/everolimus, alpelisib/trametinib), compared to cluster 1. Cabozantinib/everolimus was the most effective combination therapy with overall synergistic effects. Everolimus alone leads to development of resistance after less than one year in NET patients (Yao et al. 2011, 2016) – possibly amongst others through c-MET activation (Aristizabal Prada et al. 2018, Van den Bossche et al. 2020). The combination of everolimus with the c-MET inhibitor cabozantinib might therefore overcome everolimus resistance.
The second most effective combination alpelisib/trametinib showed overall synergistic effects, most likely due to an alpelisib-mediated attenuation of trametinib-induced AKT activation and simultaneous trametinib-mediated ERK inhibition. However, similar to everolimus/trametinib combination treatment (Tolcher et al. 2015), alpelisib/trametinib may lead to increased toxicity in patients through the inhibition of two essential signaling pathways.
Nevertheless, combination treatment with sunitinib and the mTORC1 inhibitor rapamycin was clinically well tolerated and effective at low doses (Ayala-Ramirez et al. 2012, Waqar et al. 2013). Consistent with our previously published data (Fankhauser et al. 2019, Helm et al. 2022), alpelisib/everolimus treatment showed strong efficacy with synergism in cluster 2 through dual inhibition of PI3K/AKT and mTORC1 pathways.
However, not all of the drugs/drug combinations targeting kinase signaling pathways were effective. While trametinib/dabrafenib combination therapy is approved for the treatment of BRAF-mutant melanoma and non-small cell lung cancer (Planchard et al. 2016, Long et al. 2017), it showed no beneficial effects in PPGL primary cultures. Dabrafenib alone even led to a promotion of tumor growth, possibly via a paradoxical ERK activation (Del Curatolo et al. 2018).
There are only a few published clinical studies on molecular-targeted therapies (sunitinib, cabozantinib, everolimus) in PPGLs, with none of them distinguishing between the different molecular clusters. For sunitinib, a prospective clinical trial in PPGLs (n = 25) reported a response rate of 13% and a disease control rate (DCR) of 83% over 3 months (DCR 61% over 6 months); allpatients with SDHx-related disease showed a partial response or stable disease (O’Kane et al. 2019). One retrospective clinical trial (n = 17) described a partial response to sunitinib in 21% and a DCR of 57% over 6 months; 62.5% (5/8) of cases with stable disease or partial response were SDHB mutation carriers (Ayala-Ramirez et al. 2012). The results of the first randomized placebo-controlled clinical trial (FIRST-MAPPP) (n = 78) were recently presented at the ESMO conference and suggested that sunitinib is significantly superior to placebo (Baudin et al. 2021). Whether patients with SDHB-mutant tumors are the best candidates for sunitinib, as suggested by a small number of SDHB-related PPGL primary cultures (n = 3), is not yet known from the FIRST-MAPPP study but was also indicated by the above-mentioned small series.
For cabozantinib, an abstract of the preliminary results of a prospective clinical trial (n = 10) demonstrated a DCR of 90% (allminor or partial response) over 3 months (DCR 70% over 6 months, DCR 30% over 12 months) (PFS 11.1 months). All SDHB-mutant patients (n = 5) showed minor/partial responses (Jimenez et al. 2017). This is consistent with the primary culture data with better responsivity to cabozantinib (viability reduction by 39%) compared to sunitinib (viability reduction by 15%), and significantly stronger responsivity of cluster 1-related, compared to cluster 2-related tumors, with the best responsivity in SDHB-related tumors. It is worth mentioning that the anti-angiogenic properties of sunitinib and cabozantinib are part of their efficacy in vivo but clearly cannot be investigated in our primary culture model.
The low to moderate responsivity of human primary cultures (viability reduction by 28%) to everolimus seems somewhat more promising, compared to response rates of 0% published in one prospective and one retrospective study (n = 7, DCR 71% and n = 4, DCR 25%, respectively) (Druce et al. 2009, Oh et al. 2012).
The selective RET inhibitor selpercatinib has shown promising effects in a phase I/II clinical study in RET-mutant medullary thyroid carcinoma (LIBRETTO-001, NCT03157128 (Wirth et al. 2020)). Interestingly, selpercatinib showed poor efficacy in RET-related PPGL primary cultures and even significantly stronger efficacy in cluster 1 than in cluster 2. Since the sub-groups of tumor samples with the same mutation only contain small numbers (Table 2), there are not enough data to draw a valid conclusion for each specific mutation. For instance, we only treated three tumors with RET mutations with selpercatinib, one of which was a VUS of RET. Therefore, our data are not strong enough to interrogate the selective efficacy of selpercatinib. Additionally, it is important to mention that in a clinical setting, the efficacy of a drug represents growth inhibition as well as tumor cell death. However, in our primary culture model, neither pure growth inhibition, due to low PPGL cell growth rates and short treatment intervals (72 h), nor microenvironmental effects, including vascularization (see above), are assessable.
Chemotherapeutics, HIF-2a inhibitors, and other drugs
Apart from AR-A014418 (see above), which is not yet in clinical use, gemcitabine and high-dose zoledronic acid were the most effective single agents in both clusters, with the best responsivity of cluster 1 SDHB-related tumors. 5-FU, with significantly stronger efficacy in cluster 1, may also be an interesting therapy option for cluster 1 tumors.
The literature on chemotherapeutic treatment of PPGL other than CVD is still scarce. Consistent with our data, case reports of metastatic PPGL patients treated with gemcitabine (Pipas & Krywicki 2000, Mora et al. 2009, Costello et al. 2014) and 5-FU (Bukowski & Vidt 1984, Srimuninnimit & Wampler 1991) showed good therapy responses.
The good responsivity of the primary cultures to zoledronic acid, clinically used for the treatment of bone metastases, is consistent with a significant cancer risk reduction to 67% in osteopenic postmenopausal women treated with zoledronic acid, compared to placebo (Reid et al. 2020) and a reported inhibition of cancer cell proliferation by zoledronic acid (Wang et al. 2020).
Poorly effective agents in PPGL primary cultures included temozolomide, HIF-2a inhibitors, octreotide, and estrogen (moderate efficacy only at supraphysiological doses). As mentioned above, drug responsivity of PPGL primary cultures rather represents tumor cell death (partial response in vivo), but this neither measures disease stabilization, an important parameter of drug efficacy in vivo, nor the effects on the microenvironment. This may result in discrepancies between the primary culture and in vivo data.
In contrast to the primary culture data, a retrospective study investigating temozolomide treatment in 15 PPGL patients showed a high DCR of 80% (Hadoux et al. 2014). However, indirect antitumoral effects of temozolomide on the immune system (Di Ianni et al. 2021) or the gut microbiota (Li et al. 2021) have been discussed in glioblastoma patients/glioma cells, which are not reflected in our model. It has been shown that temozolomide in combination with PARP inhibitors may be a novel therapeutic approach in SDHB-mutant PPGLs (Pang et al. 2018). A clinical phase II study on PARP inhibitor olaparib plus temozolomide (NCT04394858) is recruiting. We confirmed a synergistic effect of the PARP inhibitor niraparib together with temozolomide in the primary cultures with highest efficacy in SDHB-related tumors.
With regards to HIF-2a inhibitors, a phase II study on VHL-associated renal cell carcinoma (RCC) treated with HIF-2a inhibitor belzutifan has shown promising preliminary results (Jonasch et al. 2021) resulting in FDA approval of belzutifan in patients with VHL-related disease (Deeks 2021). A clinical phase II trial on advanced PPGLs and pancreatic NETs (MK-6482-015, NCT04924075) is ongoing. However, consistent with our data, other preclinical studies have shown a lack of efficacy of HIF-2a inhibitors in HIF2A-related PPGLs (Bechmann et al. 2020) and VHL-mutant RCC cell lines due to the appearance of resistance (Courtney et al. 2020, Bechmann & Eisenhofer 2021).
While the somatostatin analogs octreotide and lanreotide are well established growth inhibitory agents in the treatment algorithms of NET patients (Pavel et al. 2020, Rinke et al. 2021), the preclinical in vitro data could not demonstrate significant growth inhibition in NET cells (Exner et al. 2018, Herrera-Martinez et al. 2019). Similarly, we observed no significant effect of octreotide on PPGL primary cultures. However, strong SSTR2 expression in the molecular analysis of some primary cultures indicates the potential importance of SSTR2-guided treatment depending on SSTR2 expression. Only a few case reports of somatostatin analogs in PPGL patients have been published (Tonyukuk et al. 2003, van Hulsteijn et al. 2013, Tena et al. 2018, Jha et al. 2020) and data are still lacking (Patel et al. 2021), but one phase II study investigating lanreotide in PPGL patients is currently recruiting (LAMPARA, NCT03946527).
The modest cell viability reductions in primary cultures observed during incubation with estrogen might contribute to gender-specific effects since female sex has been demonstrated to be a positive prognostic predictor in metastatic PPGL (Zheng et al. 2021).
The most important limitations of our primary culture model, such as the absent representation of the microenvironment and growth inhibition (disease stabilization), may be overcome by 3D organoid models but only in vivo models will also allow evaluation of drug toxicity.
Conclusions
We have identified several effective drugs and especially synergistic drug combinations following evaluation in human PPGL primary cultures. Interestingly, we only found minor differences in drug efficacy between cluster 1- and cluster 2-related tumors. Higher efficacy of some single anti-cancer agents (cabozantinib, selpercatinib, 5-FU) was shown in the more aggressive cluster 1-related, including SDHB-related, tumors. This may be due to the more aggressive behavior and more rapid cell growth of these tumors, making the cells more prone to drug interventions. Some targeted combination treatments and the re-purposed agents low-dose zoledronic acid and high-dose estrogen were more effective in cluster 2. We are aware that the human primary culture data may not be directly transferrable to drug responsivity in vivo, but studies are now needed to correlate and compare in vitro and in vivo data.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/ERC-21-0355.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the German Research Foundation [Deutsche Forschungsgemeinschaft (DFG)] within the CRC/Transregio 205/2, Project number: 314061271 – TRR 205 ‘The Adrenal: Central Relay in Health and Disease’ (to N B, S R, C G Z, J P, S R B, M K, M F, M R, G E, F B, N P, and S N). This work also received support of the Heuberg Foundation, Zurich, Switzerland (Working Title: ‘Novel multidimensional models for the adrenal gland and adrenal tumors’) to C H and S R B and a grant from Hochschulmedizin Zürich: Immunotherapies Targeting Endocrine Tumors (Immuno-TargET) to F B and A W.
References
Alzofon N, Koc K, Panwell K, Pozdeyev N, Marshall CB, Albuja-Cruz M, Raeburn CD, Nathanson KL, Cohen DL & Wierman ME et al.2021 Mastermind like transcriptional coactivator 3 (MAML3) drives neuroendocrine tumor progression. Molecular Cancer Research 19 1476–1485. (https://doi.org/10.1158/1541-7786.MCR-20-0992)
April-Monn SL, Wiedmer T, Skowronska M, Maire R, Schiavo Lena M, Trippel M, Di Domenico A, Muffatti F, Andreasi V & Capurso G et al.2021 Three-dimensional primary cell culture: a novel preclinical model for pancreatic neuroendocrine tumors. Neuroendocrinology 111 273–287. (https://doi.org/10.1159/000507669)
Aristizabal Prada ET, Spottl G, Maurer J, Lauseker M, Koziolek EJ, Schrader J, Grossman A, Pacak K, Beuschlein F & Auernhammer CJ et al.2018 The role of GSK3 and its reversal with GSK3 antagonism in everolimus resistance. Endocrine-Related Cancer 25 893–908. (https://doi.org/10.1530/ERC-18-0159)
Ayala-Ramirez M, Chougnet CN, Habra MA, Palmer JL, Leboulleux S, Cabanillas ME, Caramella C, Anderson P, Al Ghuzlan A & Waguespack SG et al.2012 Treatment with sunitinib for patients with progressive metastatic pheochromocytomas and sympathetic paragangliomas. Journal of Clinical Endocrinology and Metabolism 97 4040–4050. (https://doi.org/10.1210/jc.2012-2356)
Baudin E, Goichot B, Berruti A, Hadoux J, Moalla S, Laboureau S, Noelting S, Fouchardière CDL, Kienitz T & Deutschbein T et al.2021 First International Randomized Study in malignant progressive pheochromocytoma and paragangliomas (FIRSTMAPPP): an academic double-blind trial investigating sunitinib. Annals of Oncology 32 S621–S625. doi:10.1016/annonc/annonc700.
Bayley JP & Devilee P 2020 Advances in paraganglioma-pheochromocytoma cell lines and xenografts. Endocrine-Related Cancer 27 R433–R450. (https://doi.org/10.1530/ERC-19-0434)
Bechmann N & Eisenhofer G 2021 Hypoxia-inducible factor 2alpha: a key player in tumorigenesis and metastasis of pheochromocytoma and paraganglioma ? Experimental and Clinical Endocrinology and Diabetes [epub]. (https://doi.org/10.1055/a-1526-5263)
Bechmann N, Ehrlich H, Eisenhofer G, Ehrlich A, Meschke S, Ziegler CG & Bornstein SR 2018 Anti-tumorigenic and anti-metastatic activity of the sponge-derived marine drugs aeroplysinin-1 and isofistularin-3 against pheochromocytoma in vitro. Marine Drugs 16 172. (https://doi.org/10.3390/md16050172)
Bechmann N, Poser I, Seifert V, Greunke C, Ullrich M, Qin N, Walch A, Peitzsch M, Robledo M & Pacak K et al.2019 Impact of extrinsic and intrinsic hypoxia on catecholamine biosynthesis in absence or presence of Hif2alpha in pheochromocytoma cells. Cancers 11 594. (https://doi.org/10.3390/cancers11050594)
Bechmann N, Moskopp ML, Ullrich M, Calsina B, Wallace PW, Richter S, Friedemann M, Langton K, Fliedner SMJ & Timmers HJLM et al.2020 HIF2alpha supports pro-metastatic behavior in pheochromocytomas/paragangliomas. Endocrine-Related Cancer 27 625–640. (https://doi.org/10.1530/ERC-20-0205)
Bukowski RM & Vidt DG 1984 Chemotherapy trials in malignant pheochromocytoma: report of two patients and review of the literature. Journal of Surgical Oncology 27 89–92. (https://doi.org/10.1002/jso.2930270207)
Burnichon N, Vescovo L, Amar L, Libé R, De Reynies A, Venisse A, Jouanno E, Laurendeau I, Parfait B & Bertherat J et al.2011 Integrative genomic analysis reveals somatic mutations in pheochromocytoma and paraganglioma. Human Molecular Genetics 20 3974–3985. (https://doi.org/10.1093/hmg/ddr324)
Costello BA, Borad MJ, Qi Y, Kim GP, Northfelt DW, Erlichman C & Alberts SR 2014 Phase I trial of everolimus, gemcitabine and cisplatin in patients with solid tumors. Investigational New Drugs 32 710–716. (https://doi.org/10.1007/s10637-014-0096-3)
Courtney KD, Ma Y, Diaz De Leon A, Christie A, Xie Z, Woolford L, Singla N, Joyce A, Hill H & Madhuranthakam AJ et al.2020 HIF-2 complex dissociation, target inhibition, and acquired resistance with PT2385, a first-in-class HIF-2 inhibitor, in patients with clear cell renal cell carcinoma. Clinical Cancer Research 26 793–803. (https://doi.org/10.1158/1078-0432.CCR-19-1459)
Crona J, Lamarca A, Ghosal S, Welin S, Skogseid B & Pacak K 2019 Genotype-phenotype correlations in pheochromocytoma and paraganglioma: a systematic review and individual patient meta-analysis. Endocrine-Related Cancer 26 539–550. (https://doi.org/10.1530/ERC-19-0024)
Deeks ED 2021 Belzutifan: first approval. Drugs 81 1921–1927. (https://doi.org/10.1007/s40265-021-01606-x)
Del Curatolo A, Conciatori F, Cesta Incani U, Bazzichetto C, Falcone I, Corbo V, D’Agosto S, Eramo A, Sette G & Sperduti I et al.2018 Therapeutic potential of combined BRAF/MEK blockade in BRAF-wild type preclinical tumor models. Journal of Experimental and Clinical Cancer Research 37 140. (https://doi.org/10.1186/s13046-018-0820-5)
Di Ianni N, Maffezzini M, Eoli M & Pellegatta S 2021 Revisiting the immunological aspects of temozolomide considering the genetic landscape and the immune microenvironment composition of glioblastoma. Frontiers in Oncology 11 747690. (https://doi.org/10.3389/fonc.2021.747690)
Druce MR, Kaltsas GA, Fraenkel M, Gross DJ & Grossman AB 2009 Novel and evolving therapies in the treatment of malignant phaeochromocytoma: experience with the mTOR inhibitor everolimus (RAD001). Hormone and Metabolic Research 41 697–702. (https://doi.org/10.1055/s-0029-1220687)
Eisenhofer G, Lenders JW, Siegert G, Bornstein SR, Friberg P, Milosevic D, Mannelli M, Linehan WM, Adams K & Timmers HJ et al.2012 Plasma methoxytyramine: a novel biomarker of metastatic pheochromocytoma and paraganglioma in relation to established risk factors of tumour size, location and SDHB mutation status. European Journal of Cancer 48 1739–1749. (https://doi.org/10.1016/j.ejca.2011.07.016)
Exner S, Prasad V, Wiedenmann B & Grotzinger C 2018 Octreotide does not inhibit proliferation in five neuroendocrine tumor cell lines. Frontiers in Endocrinology 9 146. (https://doi.org/10.3389/fendo.2018.00146)
Fankhauser M, Bechmann N, Lauseker M, Goncalves J, Favier J, Klink B, William D, Gieldon L, Maurer J & Spottl G et al.2019 Synergistic highly potent targeted drug combinations in different pheochromocytoma models including human tumor cultures. Endocrinology 160 2600–2617. (https://doi.org/10.1210/en.2019-00410)
Fassnacht M, Assie G, Baudin E, Eisenhofer G, De La Fouchardiere C, Haak HR, De Krijger R, Porpiglia F, Terzolo M & Berruti A et al.2020 Adrenocortical carcinomas and malignant phaeochromocytomas: ESMO-EURACAN Clinical Practice Guidelines for diagnosis, treatment and follow-up. Annals of Oncology 31 1476–1490. (https://doi.org/10.1016/j.annonc.2020.08.2099)
Fishbein L, Leshchiner I, Walter V, Danilova L, Robertson AG, Johnson AR, Lichtenberg TM, Murray BA, Ghayee HK & Else T et al.2017 Comprehensive molecular characterization of pheochromocytoma and paraganglioma. Cancer Cell 31 181–193. (https://doi.org/10.1016/j.ccell.2017.01.001)
Gieldon L, William D, Hackmann K, Jahn W, Jahn A, Wagner J, Rump A, Bechmann N, Nolting S & Knosel T et al.2019 Optimizing genetic workup in pheochromocytoma and paraganglioma by integrating diagnostic and research approaches. Cancers 11 809. (https://doi.org/10.3390/cancers11060809)
Goldstein RE, O’Neill Jr JA, Holcomb 3rd GW, Morgan 3rd WM, Neblett 3rd WW, Oates JA, Brown N, Nadeau J, Smith B & Page DL et al.1999 Clinical experience over 48 years with pheochromocytoma. Annals of Surgery 229 755–764; discussion 764–766. (https://doi.org/10.1097/00000658-199906000-00001)
Hadoux J, Favier J, Scoazec JY, Leboulleux S, Al Ghuzlan A, Caramella C, Deandreis D, Borget I, Loriot C & Chougnet C et al.2014 SDHB mutations are associated with response to temozolomide in patients with metastatic pheochromocytoma or paraganglioma. International Journal of Cancer 135 2711–2720. (https://doi.org/10.1002/ijc.28913)
Hamidi O, Young Jr WF, Gruber L, Smestad J, Yan Q, Ponce OJ, Prokop L, Murad MH & Bancos I 2017 Outcomes of patients with metastatic phaeochromocytoma and paraganglioma: a systematic review and meta-analysis. Clinical Endocrinology 87 440–450. (https://doi.org/10.1111/cen.13434)
Hart T, Chandrashekhar M, Aregger M, Steinhart Z, Brown KR, Macleod G, Mis M, Zimmermann M, Fradet-Turcotte A & Sun S et al.2015 High-resolution CRISPR screens reveal fitness genes and genotype-specific cancer liabilities. Cell 163 1515–1526. (https://doi.org/10.1016/j.cell.2015.11.015)
Helm J, Drukewitz S, Poser I, Richter S, Friedemann M, William D, Mohr H, Nölting S, Robledo M & Bornstein SR et al.2022 Treatment of pheochromocytoma cells with recurrent cycles of hypoxia: a new pseudohypoxic in vitro model. Cells 11 560. (https://doi.org/10.3390/cells11030560)
Herrera-Martinez AD, Van Den Dungen R, Dogan-Oruc F, Van Koetsveld PM, Culler MD, De Herder WW, Luque RM, Feelders RA & Hofland LJ 2019 Effects of novel somatostatin-dopamine chimeric drugs in 2D and 3D cell culture models of neuroendocrine tumors. Endocrine-Related Cancer 26 585–599. (https://doi.org/10.1530/ERC-19-0086)
Hescot S, Curras-Freixes M, Deutschbein T, Van Berkel A, Vezzosi D, Amar L, De La Fouchardiere C, Valdes N, Riccardi F & Do Cao C et al.2019 Prognosis of malignant pheochromocytoma and paraganglioma (MAPP-Prono study): a European network for the study of adrenal tumors retrospective study. Journal of Clinical Endocrinology and Metabolism 104 2367–2374. (https://doi.org/10.1210/jc.2018-01968)
Jha A, Patel M, Baker E, Gonzales MK, Ling A, Millo C, Knue M, Civelek AC & Pacak K 2020 Role of 68Ga-DOTATATE PET/CT in a case of SDHB-related pterygopalatine fossa paraganglioma successfully controlled with octreotide. Nuclear Medicine and Molecular Imaging 54 48–52. (https://doi.org/10.1007/s13139-019-00629-3)
Jiang J, Zhang J, Pang Y, Bechmann N, Li M, Monteagudo M, Calsina B, Gimenez-Roqueplo AP, Nolting S & Beuschlein F et al.2020 Sino-European differences in the genetic landscape and clinical presentation of pheochromocytoma and paraganglioma. Journal of Clinical Endocrinology and Metabolism 105 dgaa502. (https://doi.org/10.1210/clinem/dgaa502)
Jimenez C, Busaidy N, Habra M, Waguespack S & Jessop A 2017 A phase 2 study to evaluate the effects of cabozantinib in patients with unresectable metastatic pheochromocytomas and paragangliomas. In International Symposium on Pheochromocytoma and Paraganglioma Sydey, Australia.
Jin XF, Spoettl G, Maurer J, Nolting S & Auernhammer CJ 2020 Inhibition of Wnt/beta-catenin signaling in neuroendocrine tumors in vitro: antitumoral effects. Cancers 12 345. (https://doi.org/10.3390/cancers12020345)
John H, Ziegler WH, Hauri D & Jaeger P 1999 Pheochromocytomas: can malignant potential be predicted? Urology 53 679–683. (https://doi.org/10.1016/s0090-4295(9800612-8)
Jonasch E, Donskov F, Iliopoulos O, Rathmell WK, Narayan VK, Maughan BL, Oudard S, Else T, Maranchie JK & Welsh SJ et al.2021 Belzutifan for renal cell carcinoma in von Hippel-Lindau disease. New England Journal of Medicine 385 2036–2046. (https://doi.org/10.1056/NEJMoa2103425)
Keith B, Johnson RS & Simon MC 2011 HIF1alpha and HIF2alpha: sibling rivalry in hypoxic tumour growth and progression. Nature Reviews: Cancer 12 9–22. (https://doi.org/10.1038/nrc3183)
Lam AK 2017 Update on adrenal tumours in 2017 World Health Organization (WHO) of endocrine tumours. Endocrine Pathology 28 213–227. (https://doi.org/10.1007/s12022-017-9484-5)
Lenders JWM, Kerstens MN, Amar L, Prejbisz A, Robledo M, Taieb D, Pacak K, Crona J, Zelinka T & Mannelli M et al.2020 Genetics, diagnosis, management and future directions of research of phaeochromocytoma and paraganglioma: a position statement and consensus of the working group on endocrine hypertension of the European Society of Hypertension. Journal of Hypertension 38 1443–1456. (https://doi.org/10.1097/HJH.0000000000002438)
Li XC, Wu BS, Jiang Y, Li J, Wang ZF, Ma C, Li YR, Yao J, Jin XQ & Li ZQ 2021 Temozolomide-induced changes in gut microbial composition in a mouse model of brain glioma. Drug Design, Development and Therapy 15 1641–1652. (https://doi.org/10.2147/DDDT.S298261)
Long GV, Hauschild A, Santinami M, Atkinson V, Mandala M, Chiarion-Sileni V, Larkin J, Nyakas M, Dutriaux C & Haydon A et al.2017 Adjuvant dabrafenib plus trametinib in stage III BRAF-mutated melanoma. New England Journal of Medicine 377 1813–1823. (https://doi.org/10.1056/NEJMoa1708539)
Luchetti A, Walsh D, Rodger F, Clark G, Martin T, Irving R, Sanna M, Yao M, Robledo M & Neumann HP et al.2015 Profiling of somatic mutations in phaeochromocytoma and paraganglioma by targeted next generation sequencing analysis. International Journal of Endocrinology 2015 138573. (https://doi.org/10.1155/2015/138573)
Mannelli M, Ianni L, Cilotti A & Conti A 1999 Pheochromocytoma in Italy: a multicentric retrospective study. European Journal of Endocrinology 141 619–624. (https://doi.org/10.1530/eje.0.1410619)
Mora J, Cruz O, Parareda A, Sola T & De Torres C 2009 Treatment of disseminated paraganglioma with gemcitabine and docetaxel. Pediatric Blood and Cancer 53 663–665. (https://doi.org/10.1002/pbc.22006)
Nölting S, Ullrich M, Pietzsch J, Ziegler CG, Eisenhofer G, Grossman A & Pacak K 2019 Current management of pheochromocytoma/paraganglioma: a guide for the practicing clinician in the era of precision medicine. Cancers 11 1505. (https://doi.org/10.3390/cancers11101505)
Nölting S, Bechmann N, Taieb D, Beuschlein F, Fassnacht M, Kroiss M, Eisenhofer G, Grossman A & Pacak K 2022 Personalized management of pheochromocytoma and paraganglioma. Endocrine Reviews 43 199–239. (https://doi.org/10.1210/endrev/bnab019)
Oh DY, Kim TW, Park YS, Shin SJ, Shin SH, Song EK, Lee HJ, Lee KW & Bang YJ 2012 Phase 2 study of everolimus monotherapy in patients with nonfunctioning neuroendocrine tumors or pheochromocytomas/paragangliomas. Cancer 118 6162–6170. (https://doi.org/10.1002/cncr.27675)
O’Kane GM, Ezzat S, Joshua AM, Bourdeau I, Leibowitz-Amit R, Olney HJ, Krzyzanowska M, Reuther D, Chin S & Wang L et al.2019 A phase 2 trial of sunitinib in patients with progressive paraganglioma or pheochromocytoma: the SNIPP trial. British Journal of Cancer 120 1113–1119. (https://doi.org/10.1038/s41416-019-0474-x)
Pang Y, Lu Y, Caisova V, Liu Y, Bullova P, Huynh TT, Zhou Y, Yu D, Frysak Z & Hartmann I et al.2018 Targeting NAD(+)/PARP DNA repair pathway as a novel therapeutic approach to SDHB-mutated cluster I pheochromocytoma and paraganglioma. Clinical Cancer Research 24 3423–3432. (https://doi.org/10.1158/1078-0432.CCR-17-3406)
Patel M, Tena I, Jha A, Taieb D & Pacak K 2021 Somatostatin receptors and analogs in pheochromocytoma and paraganglioma: old players in a new precision medicine world. Frontiers in Endocrinology 12 625312. (https://doi.org/10.3389/fendo.2021.625312)
Pavel M, Oberg K, Falconi M, Krenning EP, Sundin A, Perren A, Berruti A & ESMO Guidelines Committee. Electronic address: clinicalguidelines@esmo.org 2020 Gastroenteropancreatic neuroendocrine neoplasms: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Annals of Oncology 31 844–860. (https://doi.org/10.1016/j.annonc.2020.03.304)
Pham H, Kearns NA & Maehr R 2016 Transcriptional regulation with CRISPR/Cas9 effectors in mammalian cells. Methods in Molecular Biology 1358 43–57. (https://doi.org/10.1007/978-1-4939-3067-8_3)
Pipas JM & Krywicki RF 2000 Treatment of progressive metastatic glomus jugulare tumor (paraganglioma) with gemcitabine. Neuro-Oncology 2 190–191. (https://doi.org/10.1093/neuonc/2.3.190)
Planchard D, Kim TM, Mazieres J, Quoix E, Riely G, Barlesi F, Souquet PJ, Smit EF, Groen HJ & Kelly RJ et al.2016 Dabrafenib in patients with BRAF(V600E)-positive advanced non-small-cell lung cancer: a single-arm, multicentre, open-label, phase 2 trial. Lancet: Oncology 17 642–650. (https://doi.org/10.1016/S1470-2045(1600077-2)
Reid IR, Horne AM, Mihov B, Stewart A, Garratt E, Bastin S & Gamble GD 2020 Effects of zoledronate on cancer, cardiac events, and mortality in osteopenic older women. Journal of Bone and Mineral Research 35 20–27. (https://doi.org/10.1002/jbmr.3860)
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E & Spector E et al.2015 Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in Medicine 17 405–424. (https://doi.org/10.1038/gim.2015.30)
Rinke A, Auernhammer CJ, Bodei L, Kidd M, Krug S, Lawlor R, Marinoni I, Perren A, Scarpa A & Sorbye H et al.2021 Treatment of advanced gastroenteropancreatic neuroendocrine neoplasia, are we on the way to personalised medicine? Gut 70 1768–1781. (https://doi.org/10.1136/gutjnl-2020-321300)
Slinker BK 1998 The statistics of synergism. Journal of Molecular and Cellular Cardiology 30 723–731. (https://doi.org/10.1006/jmcc.1998.0655)
Srimuninnimit V & Wampler GL 1991 Case report of metastatic familial pheochromocytoma treated with cisplatin and 5-fluorouracil. Cancer Chemotherapy and Pharmacology 28 217–219. (https://doi.org/10.1007/BF00685513)
Tena I, Gupta G, Tajahuerce M, Benavent M, Cifrian M, Falcon A, Fonfria M, Del Olmo M, Reboll R & Conde A et al.2018 Successful second-line metronomic temozolomide in metastatic paraganglioma: case reports and review of the literature. Clinical Medicine Insights. Oncology 12 1179554918763367. (https://doi.org/10.1177/1179554918763367)
Tolcher AW, Bendell JC, Papadopoulos KP, Burris 3rd HA, Patnaik A, Jones SF, Rasco D, Cox DS, Durante M & Bellew KM et al.2015 A phase IB trial of the oral MEK inhibitor trametinib (GSK1120212) in combination with everolimus in patients with advanced solid tumors. Annals of Oncology 26 58–64. (https://doi.org/10.1093/annonc/mdu482)
Tonyukuk V, Emral R, Temizkan S, Sertcelik A, Erden I & Corapcioglu D 2003 Case report: patient with multiple paragangliomas treated with long acting somatostatin analogue. Endocrine Journal 50 507–513. (https://doi.org/10.1507/endocrj.50.507)
Turkova H, Prodanov T, Maly M, Martucci V, Adams K, Widimsky Jr J, Chen CC, Ling A, Kebebew E & Stratakis CA et al.2016 Characteristics and outcomes of metastatic Sdhb and sporadic pheochromocytoma/paraganglioma: an National Institutes of Health study. Endocrine Practice 22 302–314. (https://doi.org/10.4158/EP15725.OR)
Van den Bossche V, Jadot G, Grisay G, Pierrard J, Honoré N, Petit B, Augusto D, Sauvage S, Laes JF & Seront E 2020 c-MET as a potential resistance mechanism to everolimus in breast cancer: from a case report to patient cohort analysis. Targeted Oncology 15 139–146. (https://doi.org/10.1007/s11523-020-00704-2)
van Hulsteijn LT, Van Duinen N, Verbist BM, Jansen JC, Van Der Klaauw AA, Smit JW & Corssmit EP 2013 Effects of octreotide therapy in progressive head and neck paragangliomas: case series. Head and Neck 35 E391–E396. (https://doi.org/10.1002/hed.23348)
Wang L, Fang D, Xu J & Luo R 2020 Various pathways of zoledronic acid against osteoclasts and bone cancer metastasis: a brief review. BMC Cancer 20 1059. (https://doi.org/10.1186/s12885-020-07568-9)
Waqar SN, Gopalan PK, Williams K, Devarakonda S & Govindan R 2013 A phase I trial of sunitinib and rapamycin in patients with advanced non-small cell lung cancer. Chemotherapy 59 8–13. (https://doi.org/10.1159/000348584)
Wirth LJ, Sherman E, Robinson B, Solomon B, Kang H, Lorch J, Worden F, Brose M, Patel J & Leboulleux S et al.2020 Efficacy of selpercatinib in RET-altered thyroid cancers. New England Journal of Medicine 383 825–835. (https://doi.org/10.1056/NEJMoa2005651)
Yaeger R & Corcoran RB 2019 Targeting alterations in the RAF-MEK pathway. Cancer Discovery 9 329–341. (https://doi.org/10.1158/2159-8290.CD-18-1321)
Yao JC, Shah MH, Ito T, Bohas CL, Wolin EM, Van Cutsem E, Hobday TJ, Okusaka T, Capdevila J & De Vries EG et al.2011 Everolimus for advanced pancreatic neuroendocrine tumors. New England Journal of Medicine 364 514–523. (https://doi.org/10.1056/NEJMoa1009290)
Yao JC, Fazio N, Singh S, Buzzoni R, Carnaghi C, Wolin E, Tomasek J, Raderer M, Lahner H & Voi M et al.2016 Everolimus for the treatment of advanced, non-functional neuroendocrine tumours of the lung or gastrointestinal tract (RADIANT-4): a randomised, placebo-controlled, phase 3 study. Lancet 387 968–977. (https://doi.org/10.1016/S0140-6736(1500817-X)
Zheng L, Gu Y, Silang J, Wang J, Luo F, Zhang B, Li C & Wang F 2021 Prognostic nomograms for predicting overall survival and cancer-specific survival of patients with malignant pheochromocytoma and paraganglioma. Frontiers in Endocrinology 12 684668. (https://doi.org/10.3389/fendo.2021.684668)
